General Information of the Molecule (ID: Mol01356)
Name
hsa-mir-92a ,Homo sapiens
Synonyms
microRNA 92a-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR92A1
Gene ID
407048
Location
chr13:91351314-91351391[+]
Sequence
CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUC
CCGGCCUGUUGAGUUUGG
    Click to Show/Hide
Ensembl ID
ENSG00000283705
HGNC ID
HGNC:31643
Precursor Accession
MI0000093
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [1]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell viability Inhibition hsa05200
Notch1 signaling pathway Regulation N.A.
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
HOS cells Bone Homo sapiens (Human) CVCL_0312
HFOB cells Bone Homo sapiens (Human) CVCL_3708
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay; Transwell assay
Mechanism Description miR-92a inhibited cell growth, migration, and enhanced cisplatin sensitivity of OS cell by downregulating Notch1.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [2]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/GR cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis
Mechanism Description Increased miR17-5p and miR92a expression and decreased let-7b expression can significantly induce proliferation and inhibit apoptosis of lung cancer cells, while reducing lung cancer cell sensitivity to Gefitinib.
References
Ref 1 MiR-92a Inhibits the Progress of Osteosarcoma Cells and Increases the Cisplatin Sensitivity by Targeting Notch1. Biomed Res Int. 2018 Jun 7;2018:9870693. doi: 10.1155/2018/9870693. eCollection 2018.
Ref 2 The relationship between miR-17-5p, miR-92a, and let-7b expression with non-small cell lung cancer targeted drug resistance. J BUON. 2017 Mar-Apr;22(2):454-461.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.