Molecule Information

General Information of the Molecule (ID: Mol01349)

• Name: hsa-mir-26b ,Homo sapiens
• Synonyms: microRNA 26b
• Molecule Type: Precursor miRNA
• Gene Name: MIR26B
• Gene ID: 407017
• Location: chr2:218402646-218402722[+]
• Sequence:
  CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUA
  CUUGGCUCGGGGACCGG
• Ensembl ID: ENSG00000199121
• HGNC ID: HGNC:31612
• Precursor Accession: MI0000084

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 12 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• Experiment for Molecule Alteration: MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
• Experiment for Drug Resistance: Cell proliferation assay; Flow cytometry
• Mechanism Description: We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Obvious downregulation of miR-26b was observed in PC9/R and A549/R cells. Restoration of miR-26b partially reversed the cisplatin resistance of PC9/R and A549/R cells. Expression of TAZ was increased in PC9/R and A549/R cells compared to the parental PC9 and A549 cells. Results of dual-luciferase reporter assays verified that TAZ was targeted by miR-26b. We showed that restoration of miR-26b expression inhibited the TAZ expression and thus expanded the mitochondrial pathway of apoptosis induced by cisplatin in PC9/R and A549/R cells.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal cancer [ICD-11: 2C23.1] [3]

• Sensitive Disease: Laryngeal cancer [ICD-11: 2C23.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEp-2 cells; Skin; Homo sapiens (Human); CVCL_1906
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: Overexpression of miR26b decreases the cisplatin-resistance in laryngeal cancer by targeting ATF2. miR26b in Hep-2/R decreased the expression of ATF2, and thus inhibiting the phosphorylation of ATF2 and formation of cellular ATF2-c-Jun complex induced by cisplatin. As the results, Hep-2/R cells failed to overexpress the Bcl-xl which is a key anti-apoptotic protein under the cisplatin treatment. Therefore, overexpression of miR26b was found to be able to promote mitochondrial apoptosis induced by cisplatin.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [4]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Global microRNA profiling was performed on docetaxel-resistant and sensitive cell lines to identify candidate circulating microRNA biomarkers. Custom Taqman Array MicroRNA cards were used to measure the levels of 46 candidate microRNAs in plasma/serum samples, collected before and after docetaxel treatment, from 97 CRPC patients. Expression of hsa-mir-26b is increased.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [5]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell autophagy; Inhibition; hsa04140
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR26a/b can promote apoptosis and sensitize HCC to chemotherapy via suppressing the expression of autophagy initiator ULk.

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [6]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: NF-kappaB signaling pathway; Inhibition; hsa04064
• In Vitro Model: QGY-7703 cells; Liver; Homo sapiens (Human); CVCL_6715
• In Vitro Model: MHCC97-H cells; Liver; Homo sapiens (Human); CVCL_4972
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-26b suppresses NF-kB signaling and thereby sensitized HCC cells to the doxorubicin-induced apoptosis by inhibiting the expression of TAk1 and TAB3.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [7]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MRP-1/ABCC1; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR; Luciferase reporter assay; Western blot; Immunofluorescence staining
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Seventeen of miRNAs were differentially expressed in MCF-7/VP cells and their parent cells. The majority of these miRNAs exhibited increased expression levels, while miR-326, miR-429, miR-187, miR-7, and miR-92-2 showed decreased expression.

Mitomycin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [8]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Mitomycin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [9]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Furthermore, in OxPt-treated cells, hsa-miR-26b and hsa-miR-192 had three down-stream targets implying their important role in OxPt-resistance in HCT116, HT29 and LoVo cell lines.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [10]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT and SRB tests
• Mechanism Description: Thirty-nine out of 86 miRNAs were down-regulated 2- to 92-fold in paclitaxel-resistant prostate cancer cell lines. Of these down-regulated miRNAs, hsa-miR-17-5p, hsa-miR-19b-3p, hsa-miR-20b-5p, hsa-miR-26b-5p, hsa-miR-374b-5p, and hsa-miR-616-3p showed a considerable down-regulation (11.4- to 92.14-fold) in DU145-R cell line. Moreover, hsa-miR-19b-3p, hsa-miR-26b-5p, hsa-miR-374b-5p were also down-regulated in all paclitaxel-resistant prostate cancer cell lines.

Tamoxifen

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [11]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: MCF7/TAMR cells; Breast; Homo sapiens (Human); CVCL_EG55
• In Vitro Model: T47D/TAMR cells; Breast; Homo sapiens (Human); CVCL_1D36
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The ERBB2 expression is regulated at the post-transcriptional level by miR26a/b and the RNA-binding protein human antigen R, miR26a/b inhibits the translation of ERBB2 mRNA, whereas HuR enhances the stability of the ERBB2 mRNA.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Glioma [ICD-11: 2A00.1] [12]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SNB19 cells; Brain; Homo sapiens (Human); CVCL_0535
• In Vitro Model: T98G cells; Brain; Homo sapiens (Human); CVCL_0556
• In Vitro Model: SNB19 TR cells; Brain; Homo sapiens (Human); CVCL_0535
• In Vitro Model: T98G TR cells; Brain; Homo sapiens (Human); CVCL_0556
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT Assay; Wound healing assay; Transwell invasion assays
• Mechanism Description: miR26b reverses temozolomide resistance via targeting Wee1 in glioma cells. miR26b governed TR-mediate EMT partly due to governing its target Wee1.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [8]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.

References

• Ref 1: Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
• Ref 2: Alterations in p53 predict response to preoperative high dose chemotherapy in patients with gastric cancerMol Pathol. 2003 Oct;56(5):286-92. doi: 10.1136/mp.56.5.286.
• Ref 3: Overexpression of miR-26b decreases the cisplatin-resistance in laryngeal cancer by targeting ATF2. Oncotarget. 2017 Sep 8;8(45):79023-79033. doi: 10.18632/oncotarget.20784. eCollection 2017 Oct 3.
• Ref 4: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 5: MiR-26 enhances chemosensitivity and promotes apoptosis of hepatocellular carcinoma cells through inhibiting autophagy. Cell Death Dis. 2017 Jan 12;8(1):e2540. doi: 10.1038/cddis.2016.461.
• Ref 6: MicroRNA-26b suppresses the NF-kB signaling and enhances the chemosensitivity of hepatocellular carcinoma cells by targeting TAK1 and TAB3. Mol Cancer. 2014 Feb 24;13:35. doi: 10.1186/1476-4598-13-35.
• Ref 7: Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol. 2010 Mar 15;79(6):817-24. doi: 10.1016/j.bcp.2009.10.017. Epub 2009 Oct 31.
• Ref 8: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 9: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 10: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 11: Post-transcriptional regulation of ERBB2 by miR26a/b and HuR confers resistance to tamoxifen in estrogen receptor-positive breast cancer cells. J Biol Chem. 2017 Aug 18;292(33):13551-13564. doi: 10.1074/jbc.M117.780973. Epub 2017 Jun 21.
• Ref 12: MiR-26b reverses temozolomide resistance via targeting Wee1 in glioma cells. Cell Cycle. 2017 Oct 18;16(20):1954-1964. doi: 10.1080/15384101.2017.1367071. Epub 2017 Sep 12.