Molecule Information

General Information of the Molecule (ID: Mol01345)

• Name: hsa-mir-23a ,Homo sapiens
• Synonyms: microRNA 23a
• Molecule Type: Precursor miRNA
• Gene Name: MIR23A
• Gene ID: 407010
• Location: chr19:13836587-13836659[-]
• Sequence:
  GGCCGGCUGGGGUUCCUGGGGAUGGGAUUUGCUUCCUGUCACAAAUCACAUUGCCAGGGA
  UUUCCAACCGACC
• Ensembl ID: ENSG00000207980
• HGNC ID: HGNC:31605
• Precursor Accession: MI0000079

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 8 drug(s) in total

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR23a-3p/APAF1 axis; Regulation; N.A.
• In Vivo Model: Ovarian cancer patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Apoptotic cell death detection
• Mechanism Description: In the present paper, we identified miR-23a-3p, a hypoxia regulated-microRNA (miRNA), as a potential biomarker of chemoresistance and poor outcome in two independent cohorts of high-grade serous ovarian carcinoma (HGSOC) patients. Then, we predicted the involvement of miR-23a-3p in the platinum resistance pathway, together with its target APAF-1 gene, and validated their anticorrelation and association with platinum response in HGSOC patients and cell lines. We propose that the evaluation of miR-23a-3p expression may provide important clinical indications on patients not responding to platinum treatment and that the miR23a-3p/APAF1 axis could be considered a possible target for personalized medicine in HGSOC patients.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Tongue squamous cell carcinoma [ICD-11: 2B62.1] [2]

• Resistant Disease: Tongue squamous cell carcinoma [ICD-11: 2B62.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: JNk signaling pathway; Activation; hsa04010
• In Vitro Model: Tca8113 cells; Tongue; Homo sapiens (Human); CVCL_6851
• In Vitro Model: SCC4 cells; Tongue; Homo sapiens (Human); CVCL_1684
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-23a in both SCC-4 and Tca8113 cells markedly increased Twist expression, c-Jun N-terminal kinase (JNk) activity and the half maximal inhibitory concentration (IC50) of cisplain, and decreased cisplatin-induced apoptosis, all of which was abolished by knockdown of Twist or selective JNk inhibitor SP600125. On the other hand, knockdown of miR-23a significantly decreased Twist expression, JNk activity and IC50 of cisplain, and increased cisplatin-induced apoptosis, all of which was completely reversed by overexpression of Twist. The present study for the first time demonstrates that miR-23a promotes cisplatin chemoresistance and protects cisplatin-induced apoptosis in TSCC cells through inducing Twist expression by a JNk-dependent mechanism.

Disease Class: Tongue squamous cell carcinoma [ICD-11: 2B62.1] [3]

• Resistant Disease: Tongue squamous cell carcinoma [ICD-11: 2B62.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Tca8113 cells; Tongue; Homo sapiens (Human); CVCL_6851
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Topoisomerase II is involved in DNA replication, transcription and chromosome segregation, and the beta form of DNA topoisomerase II beta (TOP2B) functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. miR-23a is an up-stream regulator of TOP2B to realize the chemoresistance of cisplatin.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4], [5]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: p53 signaling pathway; Regulation; N.A.
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Inhibition of miR-23a expression increases the sensitivity of A2780 cells to cisplatin possibly by inhibiting the negative regulation by miR-23a target genes that causes inhibition of P-gp protein expression.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [6]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Erlotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [7]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PTEN/PI3K/AKT signaling pathway; Inhibition; hsa05235
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: Inhibition of miR23a increases the sensitivity of lung cancer stem cells to erlotinib through PTEN/PI3k/Akt pathway. Transfection with miR23a inhibitors promoted the erlotinib-dependent inhibition of PI3k/AkT pathway, thus, suppressing the proliferation and inducing apoptosis in PC9 CSCs.

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [8]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: MHCC97-L cells; Liver; Homo sapiens (Human); CVCL_4973
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-23a could significantly potentiate the in vitro and in vivo anti-tumor effect of etoposide; miR-23a could directly bind to 3'untranslated region of TOP1 mRNA, and suppress the corresponding protein expression and inhibition of miR-23a further arguments the expression of TOP1. Suppression of TOP1 expression by miR-23a results in reduction of overall intracellular topoisomerase activity when the cells are exposed to etoposide, which in consequence enhances drug response of HCC cells.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [9]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: APAF-1/caspase-9 apoptotic signaling pathway; Activation; hsa04210
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-23a may inhibit 5-FU-induced apoptosis through the APAF-1/caspase-9 pathway and provide new insight into CRC treatment.

Mitomycin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [10]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Mitomycin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [10]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.

References

• Ref 1: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 2: miR-23a promotes cisplatin chemoresistance and protects against cisplatin-induced apoptosis in tongue squamous cell carcinoma cells through Twist. Oncol Rep. 2015 Feb;33(2):942-50. doi: 10.3892/or.2014.3664. Epub 2014 Dec 10.
• Ref 3: MicroRNAs contribute to the chemoresistance of cisplatin in tongue squamous cell carcinoma lines. Oral Oncol. 2010 Apr;46(4):317-22. doi: 10.1016/j.oraloncology.2010.02.002. Epub 2010 Mar 9.
• Ref 4: [Inhibition of microRNA-23a increases cisplatin sensitivity of ovarian cancer cells: the possible molecular mechanisms]. Nan Fang Yi Ke Da Xue Xue Bao. 2015 Jan;35(1):125-8.
• Ref 5: Molecular mechanism of increased sensitivity of cisplatin to ovarian cancer by inhibition of microRNA-23a expression. Int J Clin Exp Med. 2015 Aug 15;8(8):13329-34. eCollection 2015.
• Ref 6: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 7: Inhibition of miR-23a increases the sensitivity of lung cancer stem cells to erlotinib through PTEN/PI3K/Akt pathway. Oncol Rep. 2017 Nov;38(5):3064-3070. doi: 10.3892/or.2017.5938. Epub 2017 Sep 4.
• Ref 8: MiR-23a-mediated inhibition of topoisomerase 1 expression potentiates cell response to etoposide in human hepatocellular carcinoma. Mol Cancer. 2013 Oct 8;12(1):119. doi: 10.1186/1476-4598-12-119.
• Ref 9: MicroRNA-23a antisense enhances 5-fluorouracil chemosensitivity through APAF-1/caspase-9 apoptotic pathway in colorectal cancer cells. J Cell Biochem. 2014 Apr;115(4):772-84. doi: 10.1002/jcb.24721.
• Ref 10: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.