General Information of the Molecule (ID: Mol01344)
Name
hsa-mir-22 ,Homo sapiens
Synonyms
microRNA 22
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR22
Gene ID
407004
Location
chr17:1713903-1713987[-]
Sequence
GGCUGAGCCGCAGUAGUUCUUCAGUGGCAAGCUUUAUGUCCUGACCCAGCUAAAGCUGCC
AGUUGAAGAACUGUUGCCCUCUGCC
    Click to Show/Hide
Ensembl ID
ENSG00000283824
HGNC ID
HGNC:31599
Precursor Accession
MI0000078
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bromocriptine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prolactin-secreting adenoma [1]
Resistant Disease Prolactin-secreting adenoma [ICD-11: 2F37.Y]
Resistant Drug Bromocriptine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model KHM-5M cells Pleural effusion Homo sapiens (Human) CVCL_2975
Experiment for
Molecule Alteration
Solexa sequencing assay; qRT-PCR
Experiment for
Drug Resistance
Clinical diagnostic evaluation
Mechanism Description Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [2]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-22 overexpression sensitizes MG-63 cells to cisplatin treatment and reduces the expression of S100A11.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [3]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SW620 cells Colon Homo sapiens (Human) CVCL_0547
RkO cells Colon Homo sapiens (Human) CVCL_0504
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; RT-PCR
Experiment for
Drug Resistance
Trypan blue exclusion assay
Mechanism Description Tumor cells undergoing autophagy may affect the sensitivity of 5-FU by repressing miR-22 expression. miR-22 will facilitate 5-FU to kill tumor cells when it was exotically introduced into the tumor cells, and tumor cells with higher levels of miR-22 were more sensitive to 5-FU. starvation induced up-regulation of BTG1 in CRC cells was inversely correlated with miR-22, which further demonstrated that miR-22 may influence cells under stress. More importantly, BTG1 can reverse the inhibition of autophagy induced by overexpression of miR-22, and the knockdown of BTG1 can reduce the level of autophagy resulting from the down-regulation of miR-22 in CRC cells with 5-FU treatment. Similarly, the data from clinical samples indicated that the miR-22 level was inversely correlated with the expression of BTG1, and the tumors with higher miR-22 level were more sensitive to 5-FU.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [4]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDM231 cells Breast Homo sapiens (Human) CVCL_5T76
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description microRNA-22 sensitized breast cancer cells to paclitaxel by downregulation of NRAS.
Disease Class: Colon cancer [5]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model HT-29 cells Colon Homo sapiens (Human) CVCL_0320
HCT15 cells Colon Homo sapiens (Human) CVCL_0292
Experiment for
Molecule Alteration
Northern blotting analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of miR-22 enhanced the anticancer effect of paclitaxel in the p53-mutated cells through increasing cell apoptosis and reducing cell proliferation and survival. The anticancer role of miR-22 was mediated by activation of PTEN signaling, subsequent inhibition of Akt Ser473 phosphorylation and MTDH expression, as well as upregulation of Bax and active caspase-3 levels.
References
Ref 1 MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
Ref 2 MicroRNA 22 inhibits the proliferation and migration, and increases the cisplatin sensitivity, of osteosarcoma cells. Mol Med Rep. 2018 May;17(5):7209-7217. doi: 10.3892/mmr.2018.8790. Epub 2018 Mar 20.
Ref 3 MiR-22 regulates 5-FU sensitivity by inhibiting autophagy and promoting apoptosis in colorectal cancer cells. Cancer Lett. 2015 Jan 28;356(2 Pt B):781-90. doi: 10.1016/j.canlet.2014.10.029. Epub 2014 Oct 29.
Ref 4 MicroRNA-22 Suppresses Breast Cancer Cell Growth and Increases Paclitaxel Sensitivity by Targeting NRAS. Technol Cancer Res Treat. 2018 Jan 1;17:1533033818809997. doi: 10.1177/1533033818809997.
Ref 5 Overexpression of miR-22 reverses paclitaxel-induced chemoresistance through activation of PTEN signaling in p53-mutated colon cancer cells. Mol Cell Biochem. 2011 Nov;357(1-2):31-8. doi: 10.1007/s11010-011-0872-8. Epub 2011 May 19.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.