Molecule Information

General Information of the Molecule (ID: Mol01344)

• Name: hsa-mir-22 ,Homo sapiens
• Synonyms: microRNA 22
• Molecule Type: Precursor miRNA
• Gene Name: MIR22
• Gene ID: 407004
• Location: chr17:1713903-1713987[-]
• Sequence:
  GGCUGAGCCGCAGUAGUUCUUCAGUGGCAAGCUUUAUGUCCUGACCCAGCUAAAGCUGCC
  AGUUGAAGAACUGUUGCCCUCUGCC
• Ensembl ID: ENSG00000283824
• HGNC ID: HGNC:31599
• Precursor Accession: MI0000078

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Bromocriptine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [1]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Bromocriptine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: KHM-5M cells; Pleural effusion; Homo sapiens (Human); CVCL_2975
• Experiment for Molecule Alteration: Solexa sequencing assay; qRT-PCR
• Experiment for Drug Resistance: Clinical diagnostic evaluation
• Mechanism Description: Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [2]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-22 overexpression sensitizes MG-63 cells to cisplatin treatment and reduces the expression of S100A11.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [3]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; RT-PCR
• Experiment for Drug Resistance: Trypan blue exclusion assay
• Mechanism Description: Tumor cells undergoing autophagy may affect the sensitivity of 5-FU by repressing miR-22 expression. miR-22 will facilitate 5-FU to kill tumor cells when it was exotically introduced into the tumor cells, and tumor cells with higher levels of miR-22 were more sensitive to 5-FU. starvation induced up-regulation of BTG1 in CRC cells was inversely correlated with miR-22, which further demonstrated that miR-22 may influence cells under stress. More importantly, BTG1 can reverse the inhibition of autophagy induced by overexpression of miR-22, and the knockdown of BTG1 can reduce the level of autophagy resulting from the down-regulation of miR-22 in CRC cells with 5-FU treatment. Similarly, the data from clinical samples indicated that the miR-22 level was inversely correlated with the expression of BTG1, and the tumors with higher miR-22 level were more sensitive to 5-FU.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDM231 cells; Breast; Homo sapiens (Human); CVCL_5T76
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: microRNA-22 sensitized breast cancer cells to paclitaxel by downregulation of NRAS.

Disease Class: Colon cancer [5]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: HCT15 cells; Colon; Homo sapiens (Human); CVCL_0292
• Experiment for Molecule Alteration: Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-22 enhanced the anticancer effect of paclitaxel in the p53-mutated cells through increasing cell apoptosis and reducing cell proliferation and survival. The anticancer role of miR-22 was mediated by activation of PTEN signaling, subsequent inhibition of Akt Ser473 phosphorylation and MTDH expression, as well as upregulation of Bax and active caspase-3 levels.

References

• Ref 1: MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
• Ref 2: MicroRNA 22 inhibits the proliferation and migration, and increases the cisplatin sensitivity, of osteosarcoma cells. Mol Med Rep. 2018 May;17(5):7209-7217. doi: 10.3892/mmr.2018.8790. Epub 2018 Mar 20.
• Ref 3: MiR-22 regulates 5-FU sensitivity by inhibiting autophagy and promoting apoptosis in colorectal cancer cells. Cancer Lett. 2015 Jan 28;356(2 Pt B):781-90. doi: 10.1016/j.canlet.2014.10.029. Epub 2014 Oct 29.
• Ref 4: MicroRNA-22 Suppresses Breast Cancer Cell Growth and Increases Paclitaxel Sensitivity by Targeting NRAS. Technol Cancer Res Treat. 2018 Jan 1;17:1533033818809997. doi: 10.1177/1533033818809997.
• Ref 5: Overexpression of miR-22 reverses paclitaxel-induced chemoresistance through activation of PTEN signaling in p53-mutated colon cancer cells. Mol Cell Biochem. 2011 Nov;357(1-2):31-8. doi: 10.1007/s11010-011-0872-8. Epub 2011 May 19.