Molecule Information

General Information of the Molecule (ID: Mol01713)

Name	hsa-miR-34b-3p ,Homo sapiens
Synonyms	microRNA 34b Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	CAAUCACUAACUCCACUGCCAU Click to Show/Hide
Ensembl ID	ENSG00000207811
HGNC ID	HGNC:31636
Mature Accession	MIMAT0004676
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

5 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Bladder cancer				[1]
Resistant Disease	Bladder cancer [ICD-11: 2C94.0]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell proliferation		Activation	hsa05200
	Notch/PkC/Ca++ signaling pathway		Inhibition	hsa04330
In Vitro Model	5637 cells	Bladder	Homo sapiens (Human)	CVCL_0126
	EJ cells	Bladder	Homo sapiens (Human)	CVCL_UI82
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	miR-34b-3p represses the multidrug-chemoresistance (Paclitaxel; Pirarubicin; Epirubicin hydrochloride; Adriamycin; Cisplatin) of bladder cancer cells by regulating the CCND2 and P2RY1 genes.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Bladder cancer				[1]
Resistant Disease	Bladder cancer [ICD-11: 2C94.0]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell proliferation		Activation	hsa05200
	Notch/PkC/Ca++ signaling pathway		Inhibition	hsa04330
In Vitro Model	5637 cells	Bladder	Homo sapiens (Human)	CVCL_0126
	EJ cells	Bladder	Homo sapiens (Human)	CVCL_UI82
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	miR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes.

Epirubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Bladder cancer				[1]
Resistant Disease	Bladder cancer [ICD-11: 2C94.0]			Disease Info
Resistant Drug	Epirubicin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell proliferation		Activation	hsa05200
	Notch/PkC/Ca++ signaling pathway		Inhibition	hsa04330
In Vitro Model	5637 cells	Bladder	Homo sapiens (Human)	CVCL_0126
	EJ cells	Bladder	Homo sapiens (Human)	CVCL_UI82
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	miR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes.

Paclitaxel

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Bladder cancer				[1]
Resistant Disease	Bladder cancer [ICD-11: 2C94.0]			Disease Info
Resistant Drug	Paclitaxel			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell proliferation		Activation	hsa05200
	Notch/PkC/Ca++ signaling pathway		Inhibition	hsa04330
In Vitro Model	5637 cells	Bladder	Homo sapiens (Human)	CVCL_0126
	EJ cells	Bladder	Homo sapiens (Human)	CVCL_UI82
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	miR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes.

Pirarubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Bladder cancer				[1]
Resistant Disease	Bladder cancer [ICD-11: 2C94.0]			Disease Info
Resistant Drug	Pirarubicin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell proliferation		Activation	hsa05200
	Notch/PkC/Ca++ signaling pathway		Inhibition	hsa04330
In Vitro Model	5637 cells	Bladder	Homo sapiens (Human)	CVCL_0126
	EJ cells	Bladder	Homo sapiens (Human)	CVCL_UI82
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	miR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes.

References

Ref 1	MiR-34b-3p Represses the Multidrug-Chemoresistance of Bladder Cancer Cells by Regulating the CCND2 and P2RY1 Genes. Med Sci Monit. 2019 Feb 19;25:1323-1335. doi: 10.12659/MSM.913746.