Molecule Information

General Information of the Molecule (ID: Mol01659)
Name
hsa-miR-146b-5p ,Homo sapiens
Synonyms
microRNA 146b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGAGAACUGAAUUCCAUAGGCUG
    Click to Show/Hide
Ensembl ID
ENSG00000202569
HGNC ID
HGNC:32079
Mature Accession
MIMAT0002809
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
Click to Show/Hide the Full List of Drugs
Carboplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Carboplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [2]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
Wnt/Beta-catenin signaling pathway Regulation hsa04310
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
hFOB1.19 cells Fetal bone Homo sapiens (Human) CVCL_3708
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description miR-146b-5p was highly expressed in human osteosarcoma tissues and an elevated expression of miR-146b-5p was observed in human osteosarcoma tissues after chemotherapy. Furthermore, it was shown that miR-146b-5p overexpression promoted migration and invasiveness. miR-146b-5p overexpression also increased resistance to chemotherapy. Moreover, knockdown of miR-146b-5p substantially inhibited migration and invasion of osteosarcoma cells as well as rendered them significantly more sensitive to chemotherapy. Results of western blot assay indicated that miR-146b-5p increased MMP-16 protein expression and showed a decrease of ZNRF3 protein. Whereas, IWR-1-endo, an inhibitor of Wnt/beta-catenin, suppressed the decrease in apoptosis of osteosarcoma cells caused by miR-146b-5p overexpression. These results indicated that miR-146b-5p promoted proliferation, migration and invasiveness.
Disease Class: Hepatocellular carcinoma [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [2]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
Cell viability Activation hsa05200
Wnt/Beta-catenin signaling pathway Regulation hsa04310
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
hFOB1.19 cells Fetal bone Homo sapiens (Human) CVCL_3708
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description miR-146b-5p was highly expressed in human osteosarcoma tissues and an elevated expression of miR-146b-5p was observed in human osteosarcoma tissues after chemotherapy. Furthermore, it was shown that miR-146b-5p overexpression promoted migration and invasiveness. miR-146b-5p overexpression also increased resistance to chemotherapy. Moreover, knockdown of miR-146b-5p substantially inhibited migration and invasion of osteosarcoma cells as well as rendered them significantly more sensitive to chemotherapy. Results of western blot assay indicated that miR-146b-5p increased MMP-16 protein expression and showed a decrease of ZNRF3 protein. Whereas, IWR-1-endo, an inhibitor of Wnt/beta-catenin, suppressed the decrease in apoptosis of osteosarcoma cells caused by miR-146b-5p overexpression. These results indicated that miR-146b-5p promoted proliferation, migration and invasiveness.
Disease Class: Hepatocellular carcinoma [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [3]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.
Methotrexate
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [2]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Methotrexate
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
Wnt/Beta-catenin signaling pathway Regulation hsa04310
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
hFOB1.19 cells Fetal bone Homo sapiens (Human) CVCL_3708
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description miR-146b-5p was highly expressed in human osteosarcoma tissues and an elevated expression of miR-146b-5p was observed in human osteosarcoma tissues after chemotherapy. Furthermore, it was shown that miR-146b-5p overexpression promoted migration and invasiveness. miR-146b-5p overexpression also increased resistance to chemotherapy. Moreover, knockdown of miR-146b-5p substantially inhibited migration and invasion of osteosarcoma cells as well as rendered them significantly more sensitive to chemotherapy. Results of western blot assay indicated that miR-146b-5p increased MMP-16 protein expression and showed a decrease of ZNRF3 protein. Whereas, IWR-1-endo, an inhibitor of Wnt/beta-catenin, suppressed the decrease in apoptosis of osteosarcoma cells caused by miR-146b-5p overexpression. These results indicated that miR-146b-5p promoted proliferation, migration and invasiveness.
Mitomycin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Mitomycin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [4]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
 Disease Info 
Sensitive Drug Temozolomide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation AKT/NF-kappaB signaling pathway Inhibition hsa05135
In Vitro Model U251-MG cells Brain Homo sapiens (Human) CVCL_0021
U87-MG cells Brain Homo sapiens (Human) CVCL_0022
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR 146b 5p suppresses glioblastoma cell resistance to temozolomide through targeting TRAF6. Overexpression of miR 146b 5p or TRAF6 knockdown significantly decreased the level of p AkT and p p65.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCC Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.
References
Ref 1 Differential miRNA expression profiles in hepatocellular carcinoma cells and drug-resistant sublines. Oncol Rep. 2013 Feb;29(2):555-62. doi: 10.3892/or.2012.2155. Epub 2012 Nov 28.
Ref 2 miR-146b-5p promotes invasion and metastasis contributing to chemoresistance in osteosarcoma by targeting zinc and ring finger 3. Oncol Rep. 2016 Jan;35(1):275-83. doi: 10.3892/or.2015.4393. Epub 2015 Nov 4.
Ref 3 miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
Ref 4 miR 146b 5p suppresses glioblastoma cell resistance to temozolomide through targeting TRAF6. Oncol Rep. 2017 Nov;38(5):2941-2950. doi: 10.3892/or.2017.5970. Epub 2017 Sep 19.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.