Molecule Information

General Information of the Molecule (ID: Mol01574)
Name
hsa-miR-34a-5p ,Homo sapiens
Synonyms
microRNA 34a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UGGCAGUGUCUUAGCUGGUUGU
    Click to Show/Hide
Ensembl ID
ENSG00000284357
HGNC ID
HGNC:31635
Mature Accession
MIMAT0000255
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Carboplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Carboplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model G-292 cells Bone Homo sapiens (Human) CVCL_2909
SJSA-1 cells Bone Homo sapiens (Human) CVCL_1697
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Annexin V-FITC/propidium iodide (PI) staining assay
Mechanism Description The miR34a-5p promotes the multi-chemoresistance of osteosarcoma via repression of the AGTR1 gene.
Disease Class: Osteosarcoma [2]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Carboplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
MEF2 signaling pathway Regulation hsa04013
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
G-292 cells Bone Homo sapiens (Human) CVCL_2909
SJSA-1 cells Bone Homo sapiens (Human) CVCL_1697
MG63.2 cells Bone Homo sapiens (Human) CVCL_R705
MNNG/HOS cells Bone Homo sapiens (Human) CVCL_0439
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The down-regulation of CD117 mediated by miR-34a-5p might be one of the reasons for OS drug resistance. CD117 may also regulate other processes, including cell adhesion, differentiation and migration, which are significant for cancer development and treatment.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1], [3]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation ATF2/ATF3/ATF4 signaling pathway Inhibition hsa04915
In Vitro Model G-292 cells Bone Homo sapiens (Human) CVCL_2909
SJSA-1 cells Bone Homo sapiens (Human) CVCL_1697
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Annexin V-FITC/propidium iodide (PI) staining assay
Mechanism Description The miR34a-5p promotes the multi-chemoresistance of osteosarcoma via repression of the AGTR1 gene. And miR34a-5p promotes multi-chemoresistance of osteosarcoma through down-regulation of the DLL1 gene.
Disease Class: Osteosarcoma [2]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
MEF2 signaling pathway Regulation hsa04013
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
G-292 cells Bone Homo sapiens (Human) CVCL_2909
SJSA-1 cells Bone Homo sapiens (Human) CVCL_1697
MG63.2 cells Bone Homo sapiens (Human) CVCL_R705
MNNG/HOS cells Bone Homo sapiens (Human) CVCL_0439
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The down-regulation of CD117 mediated by miR-34a-5p might be one of the reasons for OS drug resistance. CD117 may also regulate other processes, including cell adhesion, differentiation and migration, which are significant for cancer development and treatment.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1], [3]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation ATF2/ATF3/ATF4 signaling pathway Inhibition hsa04915
In Vitro Model G-292 cells Bone Homo sapiens (Human) CVCL_2909
SJSA-1 cells Bone Homo sapiens (Human) CVCL_1697
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Annexin V-FITC/propidium iodide (PI) staining assay
Mechanism Description The miR34a-5p promotes the multi-chemoresistance of osteosarcoma via repression of the AGTR1 gene. And miR34a-5p promotes multi-chemoresistance of osteosarcoma through down-regulation of the DLL1 gene.
Disease Class: Osteosarcoma [2]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
MEF2 signaling pathway Regulation hsa04013
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
G-292 cells Bone Homo sapiens (Human) CVCL_2909
SJSA-1 cells Bone Homo sapiens (Human) CVCL_1697
MG63.2 cells Bone Homo sapiens (Human) CVCL_R705
MNNG/HOS cells Bone Homo sapiens (Human) CVCL_0439
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The down-regulation of CD117 mediated by miR-34a-5p might be one of the reasons for OS drug resistance. CD117 may also regulate other processes, including cell adhesion, differentiation and migration, which are significant for cancer development and treatment.
Etoposide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1], [3]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Etoposide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation ATF2/ATF3/ATF4 signaling pathway Inhibition hsa04915
In Vitro Model G-292 cells Bone Homo sapiens (Human) CVCL_2909
SJSA-1 cells Bone Homo sapiens (Human) CVCL_1697
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Annexin V-FITC/propidium iodide (PI) staining assay
Mechanism Description The miR34a-5p promotes the multi-chemoresistance of osteosarcoma via repression of the AGTR1 gene. And miR34a-5p promotes multi-chemoresistance of osteosarcoma through down-regulation of the DLL1 gene.
Disease Class: Osteosarcoma [2]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Etoposide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
MEF2 signaling pathway Regulation hsa04013
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
G-292 cells Bone Homo sapiens (Human) CVCL_2909
SJSA-1 cells Bone Homo sapiens (Human) CVCL_1697
MG63.2 cells Bone Homo sapiens (Human) CVCL_R705
MNNG/HOS cells Bone Homo sapiens (Human) CVCL_0439
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The down-regulation of CD117 mediated by miR-34a-5p might be one of the reasons for OS drug resistance. CD117 may also regulate other processes, including cell adhesion, differentiation and migration, which are significant for cancer development and treatment.
Methotrexate
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [3]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Methotrexate
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation ATF2/ATF3/ATF4 signaling pathway Inhibition hsa04915
In Vitro Model G-292 cells Bone Homo sapiens (Human) CVCL_2909
SJSA-1 cells Bone Homo sapiens (Human) CVCL_1697
MG63.2 cells Bone Homo sapiens (Human) CVCL_R705
MNNG/HOS cells Bone Homo sapiens (Human) CVCL_0439
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 IC50 assay; Flow cytometric analysis
Mechanism Description miR34a-5p promotes multi-chemoresistance of osteosarcoma through down-regulation of the DLL1 gene. The activity of the ATF2/ATF3/ATF4 pathway was reduced in the miR34a-5p mimic-transfected G-292 cells but increased in the miR34a-5p antagomiRtransfected SJSA-1 cells, hence the ATF2/ATF3/ATF4 pathway was validated to be involved in the OS chemoresistance mediated by miR34a-5p.
Disease Class: Osteosarcoma [2]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Methotrexate
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
MEF2 signaling pathway Regulation hsa04013
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
G-292 cells Bone Homo sapiens (Human) CVCL_2909
SJSA-1 cells Bone Homo sapiens (Human) CVCL_1697
MG63.2 cells Bone Homo sapiens (Human) CVCL_R705
MNNG/HOS cells Bone Homo sapiens (Human) CVCL_0439
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The down-regulation of CD117 mediated by miR-34a-5p might be one of the reasons for OS drug resistance. CD117 may also regulate other processes, including cell adhesion, differentiation and migration, which are significant for cancer development and treatment.
References
Ref 1 The miR-34a-5p promotes the multi-chemoresistance of osteosarcoma via repression of the AGTR1 gene. BMC Cancer. 2017 Jan 10;17(1):45. doi: 10.1186/s12885-016-3002-x.
Ref 2 MiR-34a-5p promotes the multi-drug resistance of osteosarcoma by targeting the CD117 gene. Oncotarget. 2016 May 10;7(19):28420-34. doi: 10.18632/oncotarget.8546.
Ref 3 MiR-34a-5p promotes multi-chemoresistance of osteosarcoma through down-regulation of the DLL1 gene. Sci Rep. 2017 Mar 10;7:44218. doi: 10.1038/srep44218.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.