Molecule Information

General Information of the Molecule (ID: Mol01550)
Name
hsa-miR-22-3p ,Homo sapiens
Synonyms
microRNA 22
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AAGCUGCCAGUUGAAGAACUGU
    Click to Show/Hide
Ensembl ID
ENSG00000283824
HGNC ID
HGNC:31599
Mature Accession
MIMAT0000077
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
T24 cells Bladder Homo sapiens (Human) CVCL_0554
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
HTB-1 cells Bladder Homo sapiens (Human) CVCL_0359
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
T24 cells Bladder Homo sapiens (Human) CVCL_0554
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
HTB-1 cells Bladder Homo sapiens (Human) CVCL_0359
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells.
Epirubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
 Disease Info 
Resistant Drug Epirubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
T24 cells Bladder Homo sapiens (Human) CVCL_0554
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
HTB-1 cells Bladder Homo sapiens (Human) CVCL_0359
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
T24 cells Bladder Homo sapiens (Human) CVCL_0554
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
HTB-1 cells Bladder Homo sapiens (Human) CVCL_0359
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
T24 cells Bladder Homo sapiens (Human) CVCL_0554
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
HTB-1 cells Bladder Homo sapiens (Human) CVCL_0359
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells.
Pirarubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
 Disease Info 
Resistant Drug Pirarubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
T24 cells Bladder Homo sapiens (Human) CVCL_0554
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
HTB-1 cells Bladder Homo sapiens (Human) CVCL_0359
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Hydroxycamptothecin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
 Disease Info 
Resistant Drug Hydroxycamptothecin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
T24 cells Bladder Homo sapiens (Human) CVCL_0554
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
HTB-1 cells Bladder Homo sapiens (Human) CVCL_0359
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells.
References
Ref 1 miR 22 3p enhances multi chemoresistance by targeting NET1 in bladder cancer cells. Oncol Rep. 2018 Jun;39(6):2731-2740. doi: 10.3892/or.2018.6355. Epub 2018 Apr 4.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.