Molecule Information

General Information of the Molecule (ID: Mol01507)
Name
hsa-mir-495 ,Homo sapiens
Synonyms
microRNA 495
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR495
Gene ID
574453
Location
chr14:101033755-101033836[+]
Sequence
UGGUACCUGAAAAGAAGUUGCCCAUGUUAUUUUCGCUUUAUAUGUGACGAAACAAACAUG
GUGCACUUCUUUUUCGGUAUCA
    Click to Show/Hide
Ensembl ID
ENSG00000207743
HGNC ID
HGNC:32085
Precursor Accession
MI0003135
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung small cell carcinoma [1]
Resistant Disease Lung small cell carcinoma [ICD-11: 2C25.2]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model NCI-H446 cells Lung Homo sapiens (Human) CVCL_1562
NCI-H69 cells Lung Homo sapiens (Human) CVCL_1579
H69/AR cells Lung Homo sapiens (Human) CVCL_3513
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Cell scratch-wound healing assay; Flow cytometry assay
Mechanism Description miR495 promotes the chemoresistance of SCLC through the epithelial-mesenchymal transition via Etk/BMX. Ectopic expression of Etk/BMX obviously rescued the miR495 elevation elevation-induced inhibition of drug resistance.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [2]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
mTOR signaling pathway Inhibition hsa04150
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The miR-495 exerts promotive effects on GC chemosensitivity via inactivation of the mTOR signaling pathway by suppressing ERBB2.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung small cell carcinoma [1]
Resistant Disease Lung small cell carcinoma [ICD-11: 2C25.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model NCI-H446 cells Lung Homo sapiens (Human) CVCL_1562
NCI-H69 cells Lung Homo sapiens (Human) CVCL_1579
H69/AR cells Lung Homo sapiens (Human) CVCL_3513
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Cell scratch-wound healing assay; Flow cytometry assay
Mechanism Description miR495 promotes the chemoresistance of SCLC through the epithelial-mesenchymal transition via Etk/BMX. Ectopic expression of Etk/BMX obviously rescued the miR495 elevation elevation-induced inhibition of drug resistance.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Solid tumour/cancer [3]
Sensitive Disease Solid tumour/cancer [ICD-11: 2A00-2F9Z]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
A2780C cells Ovary Homo sapiens (Human) CVCL_0134
A2780DX5 cells Ovary Homo sapiens (Human) CVCL_4T98
SGC7901R cells Uterus Homo sapiens (Human) CVCL_0520
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 Annexin-V-FITC apoptosis detection assay; Caspase-3 activity assay; MTT assay; Trypan blue exclusion assay
Mechanism Description miR-495 sensitizes MDR cancer cells to the combination of doxorubicin and taxol by inhibiting MDR1 expression, miR-495 was predicted to target ABCB1, which encodes protein MDR1.
Disease Class: Gastric cancer [2]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
mTOR signaling pathway Inhibition hsa04150
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The miR-495 exerts promotive effects on GC chemosensitivity via inactivation of the mTOR signaling pathway by suppressing ERBB2.
Etoposide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung small cell carcinoma [1]
Resistant Disease Lung small cell carcinoma [ICD-11: 2C25.2]
 Disease Info 
Resistant Drug Etoposide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model NCI-H446 cells Lung Homo sapiens (Human) CVCL_1562
NCI-H69 cells Lung Homo sapiens (Human) CVCL_1579
H69/AR cells Lung Homo sapiens (Human) CVCL_3513
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Cell scratch-wound healing assay; Flow cytometry assay
Mechanism Description miR495 promotes the chemoresistance of SCLC through the epithelial-mesenchymal transition via Etk/BMX. Ectopic expression of Etk/BMX obviously rescued the miR495 elevation elevation-induced inhibition of drug resistance.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [2]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
mTOR signaling pathway Inhibition hsa04150
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The miR-495 exerts promotive effects on GC chemosensitivity via inactivation of the mTOR signaling pathway by suppressing ERBB2.
Mitomycin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [2]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Mitomycin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
mTOR signaling pathway Inhibition hsa04150
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The miR-495 exerts promotive effects on GC chemosensitivity via inactivation of the mTOR signaling pathway by suppressing ERBB2.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Solid tumour/cancer [3]
Sensitive Disease Solid tumour/cancer [ICD-11: 2A00-2F9Z]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
A2780C cells Ovary Homo sapiens (Human) CVCL_0134
A2780DX5 cells Ovary Homo sapiens (Human) CVCL_4T98
SGC7901R cells Uterus Homo sapiens (Human) CVCL_0520
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 Annexin-V-FITC apoptosis detection assay; Caspase-3 activity assay; MTT assay; Trypan blue exclusion assay
Mechanism Description miR-495 sensitizes MDR cancer cells to the combination of doxorubicin and taxol by inhibiting MDR1 expression, miR-495 was predicted to target ABCB1, which encodes protein MDR1.
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Platinum
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [4]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Platinum
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description ATP7A is a direct target gene of miR-495 and can be negatively regulated by miR-495. The inhibition of miR-495 reduced the cell sensitivity to CDDP in A549 and H1299 cells; miR-495 regulates the cell response to platinum drug resistance by modulation of ATP7A expression.
References
Ref 1 miR-495 promotes the chemoresistance of SCLC through the epithelial-mesenchymal transition via Etk/BMX. Am J Cancer Res. 2017 Mar 1;7(3):628-646. eCollection 2017.
Ref 2 MicroRNA-495 Confers Increased Sensitivity to Chemotherapeutic Agents in Gastric Cancer via the Mammalian Target of Rapamycin (mTOR) Signaling Pathway by Interacting with Human Epidermal Growth Factor Receptor 2 (ERBB2). Med Sci Monit. 2018 Aug 27;24:5960-5972. doi: 10.12659/MSM.909458.
Ref 3 miR-495 sensitizes MDR cancer cells to the combination of doxorubicin and taxol by inhibiting MDR1 expression. J Cell Mol Med. 2017 Sep;21(9):1929-1943. doi: 10.1111/jcmm.13114. Epub 2017 Apr 14.
Ref 4 miR-495 enhances the sensitivity of non-small cell lung cancer cells to platinum by modulation of copper-transporting P-type adenosine triphosphatase A (ATP7A). J Cell Biochem. 2014 Jul;115(7):1234-42. doi: 10.1002/jcb.24665.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.