Molecule Information

General Information of the Molecule (ID: Mol01451)

• Name: hsa-mir-200c ,Homo sapiens
• Synonyms: microRNA 200c
• Molecule Type: Precursor miRNA
• Gene Name: MIR200C
• Gene ID: 406985
• Location: chr12:6963699-6963766[+]
• Sequence:
  CCCUCGUCUUACCCAGCAGUGUUUGGGUGCGGUUGGGAGUCUCUAAUACUGCCGGGUAAU
  GAUGGAGG
• Ensembl ID: ENSG00000207713
• HGNC ID: HGNC:31580
• Precursor Accession: MI0000650

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 17 drug(s) in total

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: MES-OV cells; Ovary; Homo sapiens (Human); CVCL_CZ92
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: SRB colorimetric assay; Flow cytometry assay
• Mechanism Description: The miR-200 family has major roles in EMT and taxane resistance in taxane selected ovarian cancer cell variants, and that re-introduction of miR-200s was not sufficient to fully reverse the mesenchymal phenotype in these variants. Although miR-200s were able to restore paclitaxel sensitivity in one of the variants, they did not do so in the other, and produced resistance to carboplatin in both. The divergent effects of miR-200s on taxane and carboplatin cytotoxicity should be further investigated in ovarian cancers. miR-200c and miR-141 mimics conferred resistance to carboplatin in MES-OV/TP cells, similar to OVCAR-3/TP, but sensitized MES-OV to paclitaxel. Several genes involved in balancing oxidative stress were altered in OVCAR-3/TP 200c141 cells compared to controls. The miR-200 family plays major, cell-context dependent roles in regulating EMT and sensitivity to carboplatin and paclitaxel in OVCAR-3 and MES-OV cells.

Cetuximab

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cetuximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: Sk-MES-1 cells; Lung; Homo sapiens (Human); CVCL_0630
• In Vitro Model: NCI-H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: NCI-H522 cells; Lung; Homo sapiens (Human); CVCL_1567
• In Vitro Model: NCl-H596 cells; Lung; Homo sapiens (Human); CVCL_1571
• In Vitro Model: NCI-H520 cells; Lung; Homo sapiens (Human); CVCL_1566
• In Vitro Model: Calu1 cells; Lung; Homo sapiens (Human); CVCL_0608
• In Vitro Model: NCI-H1395 cells; Lung; Homo sapiens (Human); CVCL_1467
• Experiment for Molecule Alteration: Methylation-specific PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Reintroduction of miR-200c into highly invasive/aggressive NSCLC cells induced a loss of the mesenchymal phenotype by restoring E-cadherin and reducing N-cadherin expression, and inhibited in vitro cell invasion as well as in vivo metastasis formation.

Disease Class: Bladder cancer [3]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Cetuximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: EGFR signaling pathway; Regulation; hsa01521
• In Vitro Model: 253J BV cells; Bladder; Homo sapiens (Human); CVCL_7937
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Pulse-labeling cells with [3H]thymidine
• Mechanism Description: Members of the miR-200 family appear to control the EMT process and sensitivity to EGFR therapy, in bladder cancer cells and that expression of miR-200 is sufficient to restore EGFR dependency, at least in some of the mesenchymal bladder cancer cells. The targets of miR-200 include ERRFI-1, which is a novel regulator of EGFR-independent growth.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [4]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: NER signaling pathway; Activation; hsa03420
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-200c reverses drug resistance of human gastric cancer cells by targeting regulation of the NER-ERCC3/4 pathway.

Disease Class: Cervical cancer [5]

• Resistant Disease: Cervical cancer [ICD-11: 2C77.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins.

Disease Class: Endometrial cancer [5]

• Resistant Disease: Endometrial cancer [ICD-11: 2C76.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HEC-1A cells; Uterus; Homo sapiens (Human); CVCL_0293
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: The transcription factor AP-2alpha functions as a tumor suppressor by regulating various genes that are involved in cell proliferation and apoptosis. Chemotherapeutic drugs including cisplatin induce post-transcriptionally endogenous AP-2alpha, which contributes to chemosensitivity by enhancing therapy-induced apoptosis. miR-200b/200c/429 family recognized the MRE in the 3' UTR of AP-2alpha gene and negatively regulated the expression of endogenous AP-2alpha proteins.

Disease Class: Esophageal adenocarcinoma [6]

• Resistant Disease: Esophageal adenocarcinoma [ICD-11: 2B70.2]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Beta-catenin signaling pathway; Activation; hsa04520
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: Ishikawa cells; Endometrium; Homo sapiens (Human); CVCL_2529
• In Vitro Model: HEC-1A cells; Uterus; Homo sapiens (Human); CVCL_0293
• In Vitro Model: 2774 cells; Ovary; Homo sapiens (Human); CVCL_0420
• In Vitro Model: AN3CA cells; Ovary; Homo sapiens (Human); CVCL_0028
• In Vitro Model: KLE cells; Ovary; Homo sapiens (Human); CVCL_1329
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: BRD7 is known to mediate tumor suppression by down-regulation of the beta-catenin pathway through accumulation of beta-catenin in the cytoplasm. miR-200c regulated the translocation of beta-catenin from the cytoplasm to the nucleus via inhibition of BRD7, resulting in increased expression of its transcriptional target genes, cyclinD1 and c-myc, miR-200c induces additive effect on the cisplatin cytotoxicity of endometrial carcinoma cells.

Disease Class: Gastric adenocarcinoma [7]

• Resistant Disease: Gastric adenocarcinoma [ICD-11: 2B72.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Disease Class: Lung cancer [7]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/CDDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Disease Class: Esophageal cancer [8]

• Resistant Disease: Esophageal cancer [ICD-11: 2B70.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: AKT signaling pathway; Activation; hsa04151
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: TE13 cells; Esophageal; Homo sapiens (Human); CVCL_4463
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-200c as the miRNA responsible for chemoresistance in esophageal cancer. knockdown of miR-200c expression was associated with increased expression of PPP2R1B, a subunit of protein phosphatase 2A (PP2A), which is known to inhibit the phosphorylation of Akt, miR-200c-induced resistance is mediated through the Akt pathway.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [9]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: HOS cells; Bone; Homo sapiens (Human); CVCL_0312
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR; RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis; Caspase-3 Activity Assay
• Mechanism Description: miR200c regulates tumor growth and chemosensitivity to cisplatin in osteosarcoma by targeting AkT2 and inhibiting the activity of cell proliferation and cell migration.

Disease Class: Gastric cancer [10]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: BIRC6/p53-mediated apoptosis signaling pathway; Activation; hsa04210
• Cell Pathway Regulation: ZEB2 signaling pathway; Inhibition; hsa05202
• In Vitro Model: SGC7901/DDP cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-200c regulates cisplatin resistance by targeting ZEB2 in human gastric cancer cells.

Disease Class: Ovarian cancer [11]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780CP cells; Ovary; Homo sapiens (Human); CVCL_0135
• In Vitro Model: HIOSE-80 cells; Ovary; Homo sapiens (Human); CVCL_E274
• In Vitro Model: OV119 cells; Ovary; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-200b- and miR-200c-mediated downregulation of DNMTs may improve chemotherapeutic efficacy by increasing the sensitivity of cancer cells.

Disease Class: Esophageal cancer [12]

• Sensitive Disease: Esophageal cancer [ICD-11: 2B70.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Endoscopy; Computed tomography assay; Positron emission tomography assay
• Mechanism Description: Serum miR-200c levels are useful for predicting the response to chemotherapy (cisplatin, 5-fluorouracil, and Adriamycin (ACF) or cisplatin, 5-fluorouracil, and docetaxel (DCF) ) in patients with esophageal cancer who underwent preoperative chemotherapy followed by surgery.

Disease Class: Gastric cancer [13]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The knockdown of RhoE enhanced the sensitivity of SGC7901/DDP cells and changed expres-sion of some genes. Transfection of pre-miR-200c reduces RhoEexpression. miRNA-200cregulated the sensitivity of chemotherapy to cisplatin(DDP) in gastric cancer by possibly targeting RhoE.

Disease Class: Non-small cell lung cancer [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: Sk-MES-1 cells; Lung; Homo sapiens (Human); CVCL_0630
• In Vitro Model: NCI-H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: NCI-H522 cells; Lung; Homo sapiens (Human); CVCL_1567
• In Vitro Model: NCl-H596 cells; Lung; Homo sapiens (Human); CVCL_1571
• In Vitro Model: NCI-H520 cells; Lung; Homo sapiens (Human); CVCL_1566
• In Vitro Model: Calu1 cells; Lung; Homo sapiens (Human); CVCL_0608
• In Vitro Model: NCI-H1395 cells; Lung; Homo sapiens (Human); CVCL_1467
• Experiment for Molecule Alteration: Methylation-specific PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Reintroduction of miR-200c into highly invasive/aggressive NSCLC cells induced a loss of the mesenchymal phenotype by restoring E-cadherin and reducing N-cadherin expression, and inhibited in vitro cell invasion as well as in vivo metastasis formation.

Crizotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung cancer [14]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Crizotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: NCI-2228 cells; Lung; Homo sapiens (Human); CVCL_1543
• In Vitro Model: NCI-2228/CRI cells; Lung; Homo sapiens (Human); CVCL_1543
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR200c regulates crizotinib-resistant ALk-positive lung cancer cells by reversing epithelial-mesenchymal transition via targeting ZEB1.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [15]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Docetaxel-resistant cells showed a reduced E-cadherin and an increased vimentin expression accompanied by induced expression of stem cell markers compared with parental cells. Decreased Expression of miR-200c and miR-205 Is Responsible for E-Cadherin Loss in Chemotherapy-Resistant Cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal cancer [12]

• Sensitive Disease: Esophageal cancer [ICD-11: 2B70.1]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Endoscopy; Computed tomography assay; Positron emission tomography assay
• Mechanism Description: Serum miR-200c levels are useful for predicting the response to chemotherapy (cisplatin, 5-fluorouracil, and Adriamycin (ACF) or cisplatin, 5-fluorouracil, and docetaxel (DCF) ) in patients with esophageal cancer who underwent preoperative chemotherapy followed by surgery.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [16]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760).

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [17], [18], [19]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: DNA damage repair signaling pathway; Activation; hsa03410
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Activation; hsa05235
• Cell Pathway Regulation: miR151a-3p/XRCC4 signaling pathway; Regulation; hsa05206
• Cell Pathway Regulation: p53 signaling pathway; Regulation; hsa04115
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Celltiter glo assay
• Mechanism Description: The loss of miRNA-200c correlates with the acquired resistance of breast cancer cells to ADR, the loss of miRNA-200c correlated with decreased levels of E-cadherin and PTEN, and increased levels of ZEB1 and phospho-Akt (p-Akt) in ADR-resistant breast cancer cells (MCF-7/ADR cells). miRNA-200c inhibited Akt signaling through its effects on E-cadherin and PTEN, resulting in the inhibition of ADR resistance in breast cancer cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal cancer [12]

• Sensitive Disease: Esophageal cancer [ICD-11: 2B70.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Endoscopy; Computed tomography assay; Positron emission tomography assay
• Mechanism Description: Serum miR-200c levels are useful for predicting the response to chemotherapy (cisplatin, 5-fluorouracil, and Adriamycin (ACF) or cisplatin, 5-fluorouracil, and docetaxel (DCF) ) in patients with esophageal cancer who underwent preoperative chemotherapy followed by surgery.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [20]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: BT549 cells; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: HCC70 cells; Breast; Homo sapiens (Human); CVCL_1270
• In Vitro Model: Hs-578T cells; Breast; Homo sapiens (Human); CVCL_0332
• In Vitro Model: MDA-MB-361 cells; Breast; Homo sapiens (Human); CVCL_0620
• In Vitro Model: CAMA-1 cells; Breast; Homo sapiens (Human); CVCL_1115
• In Vitro Model: MCF-10-2A cells; Breast; Homo sapiens (Human); CVCL_3743
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Celltiter-blue cell viability assay
• Mechanism Description: The up-regulation of the miR-200b and miR-200c diminishes EMT by directly targeting the transcriptional repressor ZEB1 leading to up-regulation of E-cadherin. Restoration of E-cadherin expression increases the sensitivity of cancer cells to chemotherapeutic agents. Disruption of ZEB1-histone deacetylase repressor complexes and down-regulation of histone deacetylase, in particular SIRT1, positively affect the p53 apoptotic pathway leading to the increased sensitivity of breast cancer cells to chemotherapy and radiotherapy.

Epothilone B

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Endometrial cancer [21]

• Sensitive Disease: Endometrial cancer [ICD-11: 2C76.1]
• Sensitive Drug: Epothilone B
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: Hec50 cells; Endometrium; Homo sapiens (Human); CVCL_2929
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: ELISA assay
• Mechanism Description: Low or absent miR-200c results in aberrant expression of ZEB1 and consequent repression of E-cadherin. Reinstatement of miR-200c to such cells restores E-cadherin and dramatically reduces migration and invasion. One such gene, class IIIbeta-tubulin (TUBB3), which encodes a tubulin isotype normally found only in neuronal cells, is a direct target of miR-200c. Restoration of miR-200c increases sensitivity to microtubule-targeting agents by up to 85%. Since expression of TUBB3 is a common mechanism of resistance to microtubule-binding chemotherapeutic agents in many types of solid tumors, the ability of miR-200c to restore chemosensitivity to such agents may be explained by its ability to reduce TUBB3.

Erlotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Non-small cell lung cancer [22]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: TGF-Beta/miR200/MIG6 signaling pathway; Inhibition; hsa05206
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: H292 cells; Lung; Homo sapiens (Human); CVCL_0455
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: NCl-H226 cells; Lung; Homo sapiens (Human); CVCL_1544
• In Vitro Model: NCl-H1437 cells; Lung; Homo sapiens (Human); CVCL_1472
• In Vitro Model: H1703 cells; Lung; Homo sapiens (Human); CVCL_1490
• In Vitro Model: H23 cells; Lung; Homo sapiens (Human); CVCL_1547
• In Vitro Model: Calu6 cells; Lung; Homo sapiens (Human); CVCL_0236
• In Vitro Model: H1838 cells; Lung; Homo sapiens (Human); CVCL_1499
• In Vitro Model: H1915 cells; Lung; Homo sapiens (Human); CVCL_1505
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR; RT-PCR
• Experiment for Drug Resistance: Alamar Blue assay
• Mechanism Description: The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.

Disease Class: Bladder cancer [22]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: TGF-Beta/miR200/MIG6 signaling pathway; Inhibition; hsa05206
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: H292 cells; Lung; Homo sapiens (Human); CVCL_0455
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: NCl-H226 cells; Lung; Homo sapiens (Human); CVCL_1544
• In Vitro Model: NCl-H1437 cells; Lung; Homo sapiens (Human); CVCL_1472
• In Vitro Model: H1703 cells; Lung; Homo sapiens (Human); CVCL_1490
• In Vitro Model: H23 cells; Lung; Homo sapiens (Human); CVCL_1547
• In Vitro Model: Calu6 cells; Lung; Homo sapiens (Human); CVCL_0236
• In Vitro Model: H1838 cells; Lung; Homo sapiens (Human); CVCL_1499
• In Vitro Model: H1915 cells; Lung; Homo sapiens (Human); CVCL_1505
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR; RT-PCR
• Experiment for Drug Resistance: Alamar Blue assay
• Mechanism Description: The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [23]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin V/ PI staining; Caspase-3 activity assay
• Mechanism Description: Levels of PTEN and E-cadherin were reduced by knockdown of miR200c in HCT-116 cells, PTEN inactivate the AkT signaling pathway, and E-cadherin is one of the major downstream regulators of miRNA-200c contributing to EMT, which is also important to inhibit tumor invasion and proliferation as well as to induce cell apoptosis.

Disease Class: Cholangiocarcinoma [24]

• Sensitive Disease: Cholangiocarcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: QBC939 cells; Bile duct; Homo sapiens (Human); CVCL_6942
• In Vitro Model: TFk-1 cells; Bile duct; Homo sapiens (Human); CVCL_2214
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: WST cell counting kit-8
• Mechanism Description: miR-200b/c influenced the tumourigenesis of cholangiocarcinoma cells including their tumour-initiating capacity, sphere formation, and drug resistance (like fluorouracil). We further found that miR-200b/c regulated migration and invasion capacities by directly targeting rho-kinase 2 and regulated tumorigenic properties by directly targeting SUZ12 (a subunit of a polycomb repressor complex).

Disease Class: Breast cancer [25]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-453 cells; Breast; Homo sapiens (Human); CVCL_0418
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-200c and miR-203 overexpression in breast cancer cells downregulated Bmi1 expression accompanied with reversion of resistance to 5-Fu mediated by Bmi1.

Disease Class: Esophageal cancer [12]

• Sensitive Disease: Esophageal cancer [ICD-11: 2B70.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Endoscopy; Computed tomography assay; Positron emission tomography assay
• Mechanism Description: Serum miR-200c levels are useful for predicting the response to chemotherapy (cisplatin, 5-fluorouracil, and Adriamycin (ACF) or cisplatin, 5-fluorouracil, and docetaxel (DCF) ) in patients with esophageal cancer who underwent preoperative chemotherapy followed by surgery.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [26]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: PC9-ZD cells; Lung; Homo sapiens (Human); CVCL_V337
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin-V/PI assay; Wound healing assay
• Mechanism Description: miR200c enhances sensitivity of drug-resistant non-small cell lung cancer to gefitinib by suppression of PI3k/Akt signaling pathway and inhibites cell migration via targeting ZEB1.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Non-small cell lung cancer [27]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: MEK/ERK signaling pathway; Regulation; hsa04010
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Regulation; hsa04151
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: H23 cells; Lung; Homo sapiens (Human); CVCL_1547
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Ectopic expression of miR-200c resulted in partial restoration of gefitinib sensitivity in NSCLC cells with ZEB1 downrerulating.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [28]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: Re-expression of miR-200 in gemcitabine-resistant cells showed partial reversal of EMT characteristics as documented by increased expression of E-cadherin and decreased expression of vimentin, ZEB1, and slug. These results suggest that miR-200 family regulates the expression of ZEB1, slug, E-cadherin, and vimentin and that the re-expression of miR-200 could be useful for the reversal of EMT phenotype to mesenchymal-epithelial transition (MET). re-expression of miR-200 by transfection studies or treatment of gemcitabine-resistant cells with either DIM or isoflavone resulted in the down-regulation of ZEB1, slug, and vimentin, which was consistent with morphological reversal of EMT phenotype leading to epithelial morphology.

Intedanib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [29]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Intedanib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: NCI-H1650 cells; Lung; Homo sapiens (Human); CVCL_1483
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: NCI-H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: PC-14 cells; Lung; Homo sapiens (Human); CVCL_1640
• In Vitro Model: EBC-1 cells; Lung; Homo sapiens (Human); CVCL_2891
• In Vitro Model: LC-1/sq cells; Lung; Homo sapiens (Human); CVCL_3008
• In Vitro Model: LC-2/ad cells; Lung; Homo sapiens (Human); CVCL_1373
• In Vitro Model: Lk-2 cells; Lung; Homo sapiens (Human); CVCL_1377
• In Vitro Model: NCI-HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: PC-1 cells; Pancreas; Homo sapiens (Human); CVCL_S978
• In Vitro Model: PC-10 cells; Lung; Homo sapiens (Human); CVCL_7088
• In Vitro Model: QG56 cells; Lung; Homo sapiens (Human); CVCL_6943
• In Vitro Model: RERF-LCkJ cells; Lung; Homo sapiens (Human); CVCL_1654
• In Vitro Model: SQ5 cells; Lung; Homo sapiens (Human); CVCL_8273
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-200b and miR-141 associated with epithelial-mesenchymal transition (EMT) are predictive biomarkers and therapeutic targets of nintedanib in NSCLC cells. nintedanib inhibited EMT and reversed the resistance to EGFR-TkI with TGF-beta-induced EMT through miR-200 family induction in NSCLC cells. low expression of miR-200b and miR-141, resulting in high level of ZEB1 and low level of E-cadherin, was associated with the resistance to nintedanib in NSCLC cells.

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [30]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: LUCAT1/miR200c/ABCB1 pathway; Regulation; hsa05206
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: HOS cells; Bone; Homo sapiens (Human); CVCL_0312
• In Vitro Model: HFOB cells; Bone; Homo sapiens (Human); CVCL_3708
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Transwell invasion assay
• Mechanism Description: Long non-coding RNA LUCAT1 modulates methotrexate resistance in osteosarcoma via miR200c/ABCB1 axis.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [31]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Methotrexate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: P53/P21/EZH2/E-cad signaling pathway; Activation; hsa04115
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Transwell assay
• Mechanism Description: Over expression of miR-200c reduced the resistance of A549/MTX cells to MTX with the mechanism of inducing apoptosis through the P53/P21 pathway.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: MES-OV cells; Ovary; Homo sapiens (Human); CVCL_CZ92
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: SRB colorimetric assay; Flow cytometry assay
• Mechanism Description: The miR-200 family has major roles in EMT and taxane resistance in taxane selected ovarian cancer cell variants, and that re-introduction of miR-200s was not sufficient to fully reverse the mesenchymal phenotype in these variants. Although miR-200s were able to restore paclitaxel sensitivity in one of the variants, they did not do so in the other, and produced resistance to carboplatin in both. The divergent effects of miR-200s on taxane and carboplatin cytotoxicity should be further investigated in ovarian cancers. miR-200c and miR-141 mimics conferred resistance to carboplatin in MES-OV/TP cells, similar to OVCAR-3/TP, but sensitized MES-OV to paclitaxel. Several genes involved in balancing oxidative stress were altered in OVCAR-3/TP 200c141 cells compared to controls. The miR-200 family plays major, cell-context dependent roles in regulating EMT and sensitivity to carboplatin and paclitaxel in OVCAR-3 and MES-OV cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [32]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: A miRNA-200c/cathepsin L feedback loop determines paclitaxel resistance in human lung cancer A549 cells in vitro through regulating epithelial-mesenchymal transition.

Disease Class: Ovarian cancer [33]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell adhesion; Inhibition; hsa04514
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: HEY cells; Ovary; Homo sapiens (Human); CVCL_0297
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• In Vitro Model: OV 1847 cells; Breast; Homo sapiens (Human); CVCL_D703
• In Vitro Model: OVCA 420 cells; Breast; Homo sapiens (Human); CVCL_3935
• In Vivo Model: (NOD) /SCID nude mouse xenograft model; .
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of TUBB3 is thought to result in resistance to taxanes is by enhancement of the dynamic instability of microtubules, thereby counteracting the activity of microtubule targeting agents. Transient restoration of miR-200c using miRNA mimics cause a significant decrease in TUBB3 levels, thus results in the resistance to taxanes.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Endometrial cancer [21]

• Sensitive Disease: Endometrial cancer [ICD-11: 2C76.1]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: Hec50 cells; Endometrium; Homo sapiens (Human); CVCL_2929
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: ELISA assay
• Mechanism Description: Low or absent miR-200c results in aberrant expression of ZEB1 and consequent repression of E-cadherin. Reinstatement of miR-200c to such cells restores E-cadherin and dramatically reduces migration and invasion. One such gene, class IIIbeta-tubulin (TUBB3), which encodes a tubulin isotype normally found only in neuronal cells, is a direct target of miR-200c. Restoration of miR-200c increases sensitivity to microtubule-targeting agents by up to 85%. Since expression of TUBB3 is a common mechanism of resistance to microtubule-binding chemotherapeutic agents in many types of solid tumors, the ability of miR-200c to restore chemosensitivity to such agents may be explained by its ability to reduce TUBB3.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [34]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• Cell Pathway Regulation: Cell metastasis; Inhibition; hsa05205
• In Vitro Model: U87MG cells; Brain; Homo sapiens (Human); CVCL_GP63
• In Vitro Model: DBTRG-05MG cells; Brain; Homo sapiens (Human); CVCL_1169
• Experiment for Molecule Alteration: Western blotting analysis
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-200c overexpression in DBTRG cells was able to downregulate both PDHA1 and TIGAR, which are involved in OXPHOS and glycolysis regulation. PDHA1 was described as the major provider of carbon for the TCA in GB. miR-200c overexpression was able to decrease DBTRG cell mobility. The observed effect of miR-200c on the mobility of DBTRG cells could be attributed to miR-200c modulation of E-cadherin levels, and consequent repression of epithelial-mesenchymal transition (EMT).

Trastuzumab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: HER2 positive breast cancer [35]

• Resistant Disease: HER2 positive breast cancer [ICD-11: 2C60.8]
• Resistant Drug: Trastuzumab
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: TGF-beta signaling pathway; Regulation; hsa04350
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Lnc-ATB is up-regulated in TR breast cancer tissues and TR SkBR-3 cells. Up-regulation of lnc-ATB account for the trastuzumab resistance and high invasiveness of TR SkBR-3 cells. miR-200c is down-regulated and inverse correlated with lnc-ATB in TR breast cancer tissues and TR SkBR-3 cells. Lnc-ATB functions as a ceRNA by competitively biding miR-200c in TR SkBR-3 cells. Lnc-ATB up-regulates and positive correlates with ZEB1 and ZNF217 levels.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [36]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Trastuzumab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: TGF-Beta/ZEB1 signaling pathway; Inhibition; hsa04350
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-200c, which was the most significantly downregulated miRNA in trastuzumab-resistant cells, restored trastuzumab sensitivity and suppressed invasion of breast cancer cells by concurrently targeting ZNF217, a transcriptional activator of TGF-beta, and ZEB1, a known mediator of TGF-beta signaling. Restoration of miR-200c, silencing of ZEB1 or ZNF217 or blockade of TGF-beta signaling increased trastuzumab sensitivity and suppressed invasiveness of breast cancer cells.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric adenocarcinoma [7]

• Resistant Disease: Gastric adenocarcinoma [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Disease Class: Lung cancer [7]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Fas/FasL signaling pathway; Regulation; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/CDDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The anti-apoptotic protein BCL2 and XIAP were upregulated, while the miR-200bc/429 cluster was downregulated in both SGC7901/VCR and A549/CDDP cells. miR-200bc/429 cluster might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic genes BCL2 and XIAP.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Endometrial cancer [21]

• Sensitive Disease: Endometrial cancer [ICD-11: 2C76.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: Hec50 cells; Endometrium; Homo sapiens (Human); CVCL_2929
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: ELISA assay
• Mechanism Description: Low or absent miR-200c results in aberrant expression of ZEB1 and consequent repression of E-cadherin. Reinstatement of miR-200c to such cells restores E-cadherin and dramatically reduces migration and invasion. One such gene, class IIIbeta-tubulin (TUBB3), which encodes a tubulin isotype normally found only in neuronal cells, is a direct target of miR-200c. Restoration of miR-200c increases sensitivity to microtubule-targeting agents by up to 85%. Since expression of TUBB3 is a common mechanism of resistance to microtubule-binding chemotherapeutic agents in many types of solid tumors, the ability of miR-200c to restore chemosensitivity to such agents may be explained by its ability to reduce TUBB3.

References

• Ref 1: The miR-200 family differentially regulates sensitivity to paclitaxel and carboplatin in human ovarian carcinoma OVCAR-3 and MES-OV cells. Mol Oncol. 2015 Oct;9(8):1678-93. doi: 10.1016/j.molonc.2015.04.015. Epub 2015 May 16.
• Ref 2: Loss of miR-200c expression induces an aggressive, invasive, and chemoresistant phenotype in non-small cell lung cancer. Mol Cancer Res. 2010 Sep;8(9):1207-16. doi: 10.1158/1541-7786.MCR-10-0052. Epub 2010 Aug 9.
• Ref 3: miR-200 expression regulates epithelial-to-mesenchymal transition in bladder cancer cells and reverses resistance to epidermal growth factor receptor therapy. Clin Cancer Res. 2009 Aug 15;15(16):5060-72. doi: 10.1158/1078-0432.CCR-08-2245. Epub 2009 Aug 11.
• Ref 4: MicroRNA-200c reverses drug resistance of human gastric cancer cells by targeting regulation of the NER-ERCC3/4 pathway. Oncol Lett. 2019 Jul;18(1):145-152. doi: 10.3892/ol.2019.10304. Epub 2019 May 2.
• Ref 5: A miR-200b/200c/429-binding site polymorphism in the 3' untranslated region of the AP-2Alpha gene is associated with cisplatin resistance. PLoS One. 2011;6(12):e29043. doi: 10.1371/journal.pone.0029043. Epub 2011 Dec 14.
• Ref 6: The interactions between MicroRNA-200c and BRD7 in endometrial carcinoma. Gynecol Oncol. 2012 Jan;124(1):125-33. doi: 10.1016/j.ygyno.2011.09.026. Epub 2011 Oct 19.
• Ref 7: miR-200bc/429 cluster modulates multidrug resistance of human cancer cell lines by targeting BCL2 and XIAP. Cancer Chemother Pharmacol. 2012 Mar;69(3):723-31. doi: 10.1007/s00280-011-1752-3. Epub 2011 Oct 13.
• Ref 8: Overexpression of miR-200c induces chemoresistance in esophageal cancers mediated through activation of the Akt signaling pathway. Clin Cancer Res. 2011 May 1;17(9):3029-38. doi: 10.1158/1078-0432.CCR-10-2532. Epub 2011 Jan 19.
• Ref 9: MiR-200c regulates tumor growth and chemosensitivity to cisplatin in osteosarcoma by targeting AKT2. Sci Rep. 2017 Oct 19;7(1):13598. doi: 10.1038/s41598-017-14088-3.
• Ref 10: MicroRNA-200c regulates cisplatin resistance by targeting ZEB2 in human gastric cancer cells. Oncol Rep. 2017 Jul;38(1):151-158. doi: 10.3892/or.2017.5659. Epub 2017 May 22.
• Ref 11: miR-200b and miR-200c co-contribute to the cisplatin sensitivity of ovarian cancer cells by targeting DNA methyltransferases. Oncol Lett. 2019 Feb;17(2):1453-1460. doi: 10.3892/ol.2018.9745. Epub 2018 Nov 22.
• Ref 12: Circulating miR-200c levels significantly predict response to chemotherapy and prognosis of patients undergoing neoadjuvant chemotherapy for esophageal cancer. Ann Surg Oncol. 2013 Dec;20 Suppl 3:S607-15. doi: 10.1245/s10434-013-3093-4. Epub 2013 Jul 10.
• Ref 13: MicroRNA-200c regulates the sensitivity of chemotherapy of gastric cancer SGC7901/DDP cells by directly targeting RhoE. Pathol Oncol Res. 2014 Jan;20(1):93-8. doi: 10.1007/s12253-013-9664-7. Epub 2013 Jul 3.
• Ref 14: miR-200c regulates crizotinib-resistant ALK-positive lung cancer cells by reversing epithelial-mesenchymal transition via targeting ZEB1. Mol Med Rep. 2016 Nov;14(5):4135-4143. doi: 10.3892/mmr.2016.5770. Epub 2016 Sep 23.
• Ref 15: Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. Am J Pathol. 2012 Dec;181(6):2188-201. doi: 10.1016/j.ajpath.2012.08.011. Epub 2012 Oct 3.
• Ref 16: miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother. 2014 Oct;68(8):935-42. doi: 10.1016/j.biopha.2014.09.011. Epub 2014 Oct 5.
• Ref 17: Down-regulation of microRNA-200c is associated with drug resistance in human breast cancer. Med Oncol. 2012 Dec;29(4):2527-34. doi: 10.1007/s12032-011-0117-4. Epub 2011 Nov 19.
• Ref 18: miR-200c sensitizes breast cancer cells to doxorubicin treatment by decreasing TrkB and Bmi1 expression. PLoS One. 2012;7(11):e50469. doi: 10.1371/journal.pone.0050469. Epub 2012 Nov 29.
• Ref 19: miRNA-200c increases the sensitivity of breast cancer cells to doxorubicin through the suppression of E-cadherin-mediated PTEN/Akt signaling. Mol Med Rep. 2013 May;7(5):1579-84. doi: 10.3892/mmr.2013.1403. Epub 2013 Mar 28.
• Ref 20: E-cadherin transcriptional down-regulation by epigenetic and microRNA-200 family alterations is related to mesenchymal and drug-resistant phenotypes in human breast cancer cells. Int J Cancer. 2010 Jun 1;126(11):2575-83. doi: 10.1002/ijc.24972.
• Ref 21: MicroRNA-200c mitigates invasiveness and restores sensitivity to microtubule-targeting chemotherapeutic agents. Mol Cancer Ther. 2009 May;8(5):1055-66. doi: 10.1158/1535-7163.MCT-08-1046. Epub 2009 May 12.
• Ref 22: The TGFBeta-miR200-MIG6 pathway orchestrates the EMT-associated kinase switch that induces resistance to EGFR inhibitors. Cancer Res. 2014 Jul 15;74(14):3995-4005. doi: 10.1158/0008-5472.CAN-14-0110. Epub 2014 May 15.
• Ref 23: The Effect of miR-200c Inhibition on Chemosensitivity (5- FluoroUracil) in Colorectal Cancer. Pathol Oncol Res. 2018 Jan;24(1):145-151. doi: 10.1007/s12253-017-0222-6. Epub 2017 Apr 14.
• Ref 24: Direct targeting of SUZ12/ROCK2 by miR-200b/c inhibits cholangiocarcinoma tumourigenesis and metastasis. Br J Cancer. 2013 Dec 10;109(12):3092-104. doi: 10.1038/bjc.2013.655. Epub 2013 Oct 29.
• Ref 25: A Bmi1-miRNAs cross-talk modulates chemotherapy response to 5-fluorouracil in breast cancer cells. PLoS One. 2013 Sep 9;8(9):e73268. doi: 10.1371/journal.pone.0073268. eCollection 2013.
• Ref 26: miR-200c enhances sensitivity of drug-resistant non-small cell lung cancer to gefitinib by suppression of PI3K/Akt signaling pathway and inhibites cell migration via targeting ZEB1. Biomed Pharmacother. 2017 Jan;85:113-119. doi: 10.1016/j.biopha.2016.11.100. Epub 2016 Dec 5.
• Ref 27: miR-200c overexpression is associated with better efficacy of EGFR-TKIs in non-small cell lung cancer patients with EGFR wild-type. Oncotarget. 2014 Sep 15;5(17):7902-16. doi: 10.18632/oncotarget.2302.
• Ref 28: Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res. 2009 Aug 15;69(16):6704-12. doi: 10.1158/0008-5472.CAN-09-1298. Epub 2009 Aug 4.
• Ref 29: miR-200/ZEB axis regulates sensitivity to nintedanib in non-small cell lung cancer cells. Int J Oncol. 2016 Mar;48(3):937-44. doi: 10.3892/ijo.2016.3331. Epub 2016 Jan 11.
• Ref 30: Long non-coding RNA LUCAT1 modulates methotrexate resistance in osteosarcoma via miR-200c/ABCB1 axis. Biochem Biophys Res Commun. 2018 Jan 1;495(1):947-953. doi: 10.1016/j.bbrc.2017.11.121. Epub 2017 Nov 21.
• Ref 31: Over expression of miR-200c suppresses invasion and restores methotrexate sensitivity in lung cancer A549 cells. Gene. 2016 Nov 30;593(2):265-71. doi: 10.1016/j.gene.2016.07.038. Epub 2016 Jul 16.
• Ref 32: A miRNA-200c/cathepsin L feedback loop determines paclitaxel resistance in human lung cancer A549 cells in vitro through regulating epithelial-mesenchymal transition. Acta Pharmacol Sin. 2018 Jun;39(6):1034-1047. doi: 10.1038/aps.2017.164. Epub 2017 Dec 7.
• Ref 33: Restoration of miR-200c to ovarian cancer reduces tumor burden and increases sensitivity to paclitaxel. Mol Cancer Ther. 2012 Dec;11(12):2556-65. doi: 10.1158/1535-7163.MCT-12-0463. Epub 2012 Oct 16.
• Ref 34: MiR-200c-based metabolic modulation in glioblastoma cells as a strategy to overcome tumor chemoresistance. Hum Mol Genet. 2021 Nov 16;30(23):2315-2331. doi: 10.1093/hmg/ddab193.
• Ref 35: LncRNA-ATB promotes trastuzumab resistance and invasion-metastasis cascade in breast cancer. Oncotarget. 2015 May 10;6(13):11652-63. doi: 10.18632/oncotarget.3457.
• Ref 36: MiR-200c suppresses TGF-Beta signaling and counteracts trastuzumab resistance and metastasis by targeting ZNF217 and ZEB1 in breast cancer. Int J Cancer. 2014 Sep 15;135(6):1356-68. doi: 10.1002/ijc.28782. Epub 2014 Mar 3.