Molecule Information

General Information of the Molecule (ID: Mol01416)

• Name: hsa-mir-125b ,Homo sapiens
• Synonyms: microRNA 125b-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR125B1
• Gene ID: 406911
• Location: chr11:122099757-122099844[-]
• Sequence:
  UGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUACCGUUUAAAUCCACGGGU
  UAGGCUCUUGGGAGCUGCGAGUCGUGCU
• Ensembl ID: ENSG00000207971
• HGNC ID: HGNC:31506
• Precursor Accession: MI0000446

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 13 drug(s) in total

Cetuximab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Cetuximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Inhibition; hsa04310
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: CaCo2 cells; Colon; Homo sapiens (Human); CVCL_0025
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vitro Model: NCI-H508 cells; Colon; Homo sapiens (Human); CVCL_1564
• In Vitro Model: SW1116 cells; Colon; Homo sapiens (Human); CVCL_0544
• In Vitro Model: COLO 320DM cells; Colon; Homo sapiens (Human); CVCL_0219
• In Vitro Model: HCT15 cells; Colon; Homo sapiens (Human); CVCL_0292
• In Vitro Model: LS174T cells; Colon; Homo sapiens (Human); CVCL_1384
• In Vitro Model: NCI-H716 cells; Colon; Homo sapiens (Human); CVCL_1581
• In Vitro Model: SW948 cells; Colon; Homo sapiens (Human); CVCL_0632
• In Vitro Model: SW403 cells; Colon; Homo sapiens (Human); CVCL_0545
• In Vitro Model: SW48 cells; Colon; Homo sapiens (Human); CVCL_1724
• In Vitro Model: COLO205 cells; Colon; Homo sapiens (Human); CVCL_F402
• In Vitro Model: HuTu80 cells; Small intestine; Homo sapiens (Human); CVCL_1301
• In Vitro Model: LS123 cells; Colon; Homo sapiens (Human); CVCL_1383
• In Vitro Model: SK-CO-1 cells; Colon; Homo sapiens (Human); CVCL_0626
• In Vitro Model: SW837 cells; Colon; Homo sapiens (Human); CVCL_1729
• In Vitro Model: T84 cells; Colon; Homo sapiens (Human); CVCL_0555
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Luciferase reporter assay; qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR100 and miR125b coordinately repressed five Wnt/beta-catenin negative regulators, resulting in increased Wnt signaling, and Wnt inhibition in cetuximab-resistant cells restored cetuximab responsiveness.

Disease Class: Colorectal cancer [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Cetuximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Activation; hsa04310
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: GIST-T1 cells; Gastric; Homo sapiens (Human); CVCL_4976
• In Vitro Model: CAL62 cells; Thyroid gland; Homo sapiens (Human); CVCL_1112
• In Vitro Model: CAL-62 cells; Thyroid gland; Homo sapiens (Human); CVCL_1112
• In Vitro Model: CCL-131 cells; Brain; Mus musculus (Mouse); CVCL_0470
• In Vitro Model: COLO320DM cells; Colon; Homo sapiens (Human); CVCL_0219
• In Vitro Model: CT26 WT cells; Colon; Mus musculus (Mouse); CVCL_7256
• In Vitro Model: Detroit562 cells; Pleural effusion; Homo sapiens (Human); CVCL_1171
• In Vitro Model: DIPG 007 cells; Brain; Homo sapiens (Human); CVCL_VU70
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: FL83B cells; Liver; Mus musculus (Mouse); CVCL_4691
• In Vitro Model: GH3 cells; Pituitary gland; Rattus norvegicus (Rat); CVCL_0273
• In Vitro Model: GH4C1 cells; pituitary gland; Rattus norvegicus (Rat); CVCL_0276
• In Vitro Model: H1650 cells; Pleural effusion; Homo sapiens (Human); CVCL_4V01
• In Vitro Model: H9 cells; Peripheral blood; Homo sapiens (Human); CVCL_1240
• In Vitro Model: H9/HTLV cells; Peripheral blood; Homo sapiens (Human); CVCL_3514
• In Vitro Model: HEK 293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: HeLa S cells; Uterus; Homo sapiens (Human); CVCL_0058
• In Vitro Model: HeLa229 cells; Uterus; Homo sapiens (Human); CVCL_1276
• In Vitro Model: HH cells; Peripheral blood; Homo sapiens (Human); CVCL_1280
• In Vitro Model: HPrEC cells; Prostate; Homo sapiens (Human); CVCL_A2EM
• In Vitro Model: Human RPMI8226 myeloma cells; Peripheral blood; Homo sapiens (Human); CVCL_0014
• In Vitro Model: KB-C2 cells; Uterus; Homo sapiens (Human); CVCL_D600
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: miR-100HG, miR-100 and miR-125b overexpression was also observed in cetuximab-resistant colorectal cancer and head and neck squamous cell cancer cell lines and in tumors from colorectal cancer patients that progressed on cetuximab. miR-100 and miR-125b coordinately repressed five Wnt/beta-catenin negative regulators, resulting in increased Wnt signaling, and Wnt inhibition in cetuximab-resistant cells restored cetuximab responsiveness.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Nasopharyngeal carcinoma [2]

• Resistant Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: p53 signaling pathway; Inhibition; hsa04115
• In Vitro Model: CNE1 cells; Throat; Homo sapiens (Human); CVCL_6888
• In Vitro Model: CNE-2 cells; Nasopharynx; Homo sapiens (Human); CVCL_6888
• In Vitro Model: TW03 cells; Nasopharynx; Homo sapiens (Human); CVCL_6010
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: In the TW03/DDP cells, the expression levels of miR 125a and miR 125b were upregulated, and this caused downregulation of p53. Ectopic expression of these miRNAs in the TW03 cell model sensitized TW03 to cisplatin by decreasing the protein expression levels of p53, whereas ectopic expression in the antisense oligos of these microRNAs demonstrated the opposite effect. In addition, the present demonstrated that the cisplatin induced expression of miR 125a and miR 125b inhibited cisplatin induced apoptosis in the TW03 cells by decreasing the protein expression levels of p53. Taken together, the present study revealed for the first time, to the best of our knowledge, that induction of the expression of miR 125a and miR 125b by treatment with cisplatin resulted in resistance to the cisplatin drug in the NPC cells.

Disease Class: Ovarian cancer [3]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Bak1 was a direct target of miR-125b, and down-regulation of Bak1 suppressed cisplatin-induced apoptosis and led to an increased resistance to cisplatin. miR-125b has a sig-nificantly promoting effect on chemoresistance of C13* cells and up-regulation of miR-125b expression contributes to cisplatin resistance through suppression of Bak1 expression.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Nasopharyngeal carcinoma [4]

• Sensitive Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: CNE2 cells; Nasopharynx; Homo sapiens (Human); CVCL_6889
• In Vitro Model: CNE2/DDP cells; Nasopharynx; Homo sapiens (Human); CVCL_6889
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay; Flow cytometry assay-directed annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) assay
• Mechanism Description: microRNA-125b reverses the multidrug resistance of nasopharyngeal carcinoma cells via targeting of Bcl-2.

Disease Class: Gastric cancer [5]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Overexpression of miR-125b improved the chemosensitivity of DDP in HGC-27 and MGC-803 cells and miR-125b obviously inhibited the expression of HER2 at protein level in HGC-27 and MGC-803 cells.

Disease Class: Osteosarcoma [6]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: p53/p38/MAPK signaling pathway; Regulation; hsa04010
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: HOS cells; Bone; Homo sapiens (Human); CVCL_0312
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Overexpression of miR-125b inhibited proliferation, migration, and invasion of OS cells and reduced the chemotherapy resistance of OS cells to cisplatin by targeting Bcl-2.

Cyclophosphamide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [7], [8]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Cyclophosphamide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: p53 signaling pathway; Inhibition; hsa04115
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: BT20 cells; Breast; Homo sapiens (Human); CVCL_0178
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Sphere formation assay
• Mechanism Description: E2F3, and in some settings E2F1, induce apoptosis through p53-dependent or -independent pathways, Overexpression of miR-125b in MCF-7 cells significantly down-regulated E2F3 protein level, overexpression of miR-125b caused a marked inhibition of anticancer drug activity and increased resistance in breast cancer cells in vitro. And elevated miR-125b expression in chemoresistant cancer cells were due to high percentage of SP cells.

Daunorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Leukemia [9]

• Resistant Disease: Leukemia [ICD-11: 2B33.6]
• Resistant Drug: Daunorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: THP-1 cells; Blood; Homo sapiens (Human); CVCL_0006
• In Vitro Model: Jurkat cells; Pleural effusion; Homo sapiens (Human); CVCL_0065
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: REH cells; Bone marrow; Homo sapiens (Human); CVCL_1650
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Luminescent cell viability assay
• Mechanism Description: miR-125b downregulated GRk2 and PUMA, which inhibited apoptosis and induced leukemia cell resistance to DNR.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [10]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Compared to the breast cancer tissues from chemotherapy responders, 10 miRNAs were identified to be dysregulated in the chemoresistant breast cancer tissues. Three of these miRNAs were up-regulated (miR-141, miR-200c, and miR-31), and 7 were down-regulated (let-7e, miR-576-3p, miR-125b-1, miR-370, miR-145, miR-765, and miR-760).

Disease Class: Ewing sarcoma [11]

• Resistant Disease: Ewing sarcoma [ICD-11: 2B52.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: miR125b-p53/BAKT signaling pathway; Activation; hsa05206
• In Vitro Model: RD-ES cells; Bones; Homo sapiens (Human); CVCL_2169
• In Vitro Model: Sk-ES cells; Bones; Homo sapiens (Human); CVCL_0627
• In Vitro Model: Sk-N-MC cells; Bones; Homo sapiens (Human); CVCL_0530
• In Vitro Model: TC-71 cells; Bones; Homo sapiens (Human); CVCL_2213
• In Vitro Model: VH-64 cells; Bones; Homo sapiens (Human); CVCL_9672
• In Vitro Model: WE-68 cells; Bones; Homo sapiens (Human); CVCL_9717
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Celltiter-glo luminescent cell viability assay
• Mechanism Description: miR-125b led to the development of chemoresistance by suppressing the expression of p53 and Bak, and repression of miR-125b sensitized EWS cells to apoptosis induced by treatment with various cytotoxic drugs.

Disease Class: Primitive neuroectodermal tumor [11]

• Resistant Disease: Primitive neuroectodermal tumor [ICD-11: 2A00.08]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: miR125b-p53/BAKT signaling pathway; Activation; hsa05206
• In Vitro Model: RD-ES cells; Bones; Homo sapiens (Human); CVCL_2169
• In Vitro Model: Sk-ES cells; Bones; Homo sapiens (Human); CVCL_0627
• In Vitro Model: Sk-N-MC cells; Bones; Homo sapiens (Human); CVCL_0530
• In Vitro Model: TC-71 cells; Bones; Homo sapiens (Human); CVCL_2213
• In Vitro Model: VH-64 cells; Bones; Homo sapiens (Human); CVCL_9672
• In Vitro Model: WE-68 cells; Bones; Homo sapiens (Human); CVCL_9717
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Celltiter-glo luminescent cell viability assay
• Mechanism Description: miR-125b led to the development of chemoresistance by suppressing the expression of p53 and Bak, and repression of miR-125b sensitized EWS cells to apoptosis induced by treatment with various cytotoxic drugs.

Disease Class: Acute promyelocytic leukemia [12]

• Resistant Disease: Acute promyelocytic leukemia [ICD-11: 2A60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: NB4 cells; Bone marrow; Homo sapiens (Human); CVCL_0005
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-125b could promote leukemic cell proliferation and inhibit cell apoptosis by regulating the expression of tumor suppressor BCL2-antagonist/killer 1 (Bak1). transfection of a miR-125b duplex into AML cells can increase their resistance to therapeutic drugs.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [13]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: miR125b/HAX1 signaling pathway; Regulation; hsa05206
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Enforced expression of miR-125b resensitizes MCF-7/R cells to DOX via downregulation of HAX-1.

Disease Class: Chondrosarcoma [14]

• Sensitive Disease: Chondrosarcoma [ICD-11: 2B50.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Glucose metabolism signaling pathway; Regulation; hsa05230
• In Vitro Model: CH-2879 cells; Bone; Homo sapiens (Human); CVCL_9921
• In Vitro Model: OUMS-27 cells; Bone; Homo sapiens (Human); CVCL_3090
• In Vitro Model: SW1353 cells; Bone; Homo sapiens (Human); CVCL_0543
• In Vitro Model: CS-1 cells; Bone; Homo sapiens (Human); CVCL_T023
• In Vitro Model: CSPG cells; Bone; Homo sapiens (Human); N.A.
• In Vitro Model: JJ012 cells; Bone; Homo sapiens (Human); CVCL_D605
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-125b was downregulated in chondrosarcoma cells compared with normal human chondrocytes. More importantly, miR-125b was downregulated in doxorubicin resistant cancer cells, with its overexpression enhancing doxorubicin-induced cytotoxicity and apoptosis, subsequently increasing the sensitivity of chondrosarcoma cells to doxorubicin. ErbB2 was a direct target of miR-125b in chondrosarcoma cells. The inhibition of ErbB2 by overexpression of miR-125b led to suppression of glucose metabolism, which rendered chondrosarcoma cells susceptible to doxorubicin. Restoring the expression of ErbB2 and glucose metabolic enzymes recovered doxorubicin resistance in counteracting miR-125b-mediated sensitivity. Taken together, miR-125b plays a critical role in doxorubicin resistance through suppression of ErbB2-induced glucose metabolism, and it may serve as a potential target for overcoming chemoresistance in human chondrosarcoma.

Disease Class: Chondrosarcoma [14]

• Sensitive Disease: Chondrosarcoma [ICD-11: 2B50.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: CH-2879 cells; Bone; Homo sapiens (Human); CVCL_9921
• In Vitro Model: OUMS-27 cells; Bone; Homo sapiens (Human); CVCL_3090
• In Vitro Model: SW1353 cells; Bone; Homo sapiens (Human); CVCL_0543
• In Vitro Model: CS-1 cells; Bone; Homo sapiens (Human); CVCL_T023
• In Vitro Model: CSPG cells; Bone; Homo sapiens (Human); N.A.
• In Vitro Model: JJ012 cells; Bone; Homo sapiens (Human); CVCL_D605
• In Vitro Model: SNM83 cells; Cartilage; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: Western blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-143 enhances the antitumor activity of shikonin by targeting BAG3 and reducing its expression in human glioblastoma stem cell. ErbB2. miR-125 was downregulated in chondrosarcoma cells and doxorubicin resistant cells. Overexpression of miR-125 enhanced the sensitivity of both parental and doxorubicin resistant cells to doxorubicin through direct targeting on the ErbB2-mediated upregulation of glycolysis in chondrosarcoma cells. Moreover, restoration of the expression of ErbB2 and glucose metabolic enzymes in miR-125 pretransfected cells recovered the susceptibility to doxorubicin.

Epirubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [7]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Epirubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: p53 signaling pathway; Inhibition; hsa04115
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: BT20 cells; Breast; Homo sapiens (Human); CVCL_0178
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Trypan blue dye exclusion assay
• Mechanism Description: E2F3, and in some settings E2F1, induce apoptosis through p53-dependent or -independent pathways, Overexpression of miR-125b in MCF-7 cells significantly down-regulated E2F3 protein level, overexpression of miR-125b caused a marked inhibition of anticancer drug activity and increased resistance in breast cancer cells in vitro.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ewing sarcoma [11]

• Resistant Disease: Ewing sarcoma [ICD-11: 2B52.0]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: miR125b-p53/BAKT signaling pathway; Activation; hsa05206
• In Vitro Model: RD-ES cells; Bones; Homo sapiens (Human); CVCL_2169
• In Vitro Model: Sk-ES cells; Bones; Homo sapiens (Human); CVCL_0627
• In Vitro Model: Sk-N-MC cells; Bones; Homo sapiens (Human); CVCL_0530
• In Vitro Model: TC-71 cells; Bones; Homo sapiens (Human); CVCL_2213
• In Vitro Model: VH-64 cells; Bones; Homo sapiens (Human); CVCL_9672
• In Vitro Model: WE-68 cells; Bones; Homo sapiens (Human); CVCL_9717
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Celltiter-glo luminescent cell viability assay
• Mechanism Description: miR-125b led to the development of chemoresistance by suppressing the expression of p53 and Bak, and repression of miR-125b sensitized EWS cells to apoptosis induced by treatment with various cytotoxic drugs.

Disease Class: Primitive neuroectodermal tumor [11]

• Resistant Disease: Primitive neuroectodermal tumor [ICD-11: 2A00.08]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: miR125b-p53/BAKT signaling pathway; Activation; hsa05206
• In Vitro Model: RD-ES cells; Bones; Homo sapiens (Human); CVCL_2169
• In Vitro Model: Sk-ES cells; Bones; Homo sapiens (Human); CVCL_0627
• In Vitro Model: Sk-N-MC cells; Bones; Homo sapiens (Human); CVCL_0530
• In Vitro Model: TC-71 cells; Bones; Homo sapiens (Human); CVCL_2213
• In Vitro Model: VH-64 cells; Bones; Homo sapiens (Human); CVCL_9672
• In Vitro Model: WE-68 cells; Bones; Homo sapiens (Human); CVCL_9717
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Celltiter-glo luminescent cell viability assay
• Mechanism Description: miR-125b led to the development of chemoresistance by suppressing the expression of p53 and Bak, and repression of miR-125b sensitized EWS cells to apoptosis induced by treatment with various cytotoxic drugs.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [7], [8]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: p53 signaling pathway; Inhibition; hsa04115
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: BT20 cells; Breast; Homo sapiens (Human); CVCL_0178
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Sphere formation assay
• Mechanism Description: E2F3, and in some settings E2F1, induce apoptosis through p53-dependent or -independent pathways, Overexpression of miR-125b in MCF-7 cells significantly down-regulated E2F3 protein level, overexpression of miR-125b caused a marked inhibition of anticancer drug activity and increased resistance in breast cancer cells in vitro. And elevated miR-125b expression in chemoresistant cancer cells were due to high percentage of SP cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [15]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell autophagy; Activation; hsa04140
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Activation; hsa04310
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Annexin V-FITC/PI staining assay
• Mechanism Description: CXCL12/CXCR4 axis induced miR125b promotes invasion and confers 5-fluorouracil resistance through enhancing autophagy in colorectal cancer There was a negative correlation of the expression of miR125b with APC mRNA in paired human colorectal tissue specimens. The upregulation of miR125b activated the Wnt/beta-catenin signaling by targeting APC gene and contributed to 5-FU resistance through enhancing cell autophagy.

Disease Class: Hepatocellular carcinoma [16]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: THLE-2 cells; Liver; Homo sapiens (Human); CVCL_3803
• In Vitro Model: THLE-3 cells; Liver; Homo sapiens (Human); CVCL_3804
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Compared with 5-FU-sensitive cells, 5-FU-resistant cells exhibited reduced expression levels of miR-125b, and transfection of pre-miR-125b into liver cancer cells resulted in an increased sensitivity of 5-FU-resistant cells to 5-FU. Since drug resistance is a phenotype of malignant cancer cells, the finding that miR-125b expression levels are negatively correlated with 5-FU resistance in HCC cells is consistent with the reported functions of miR-125b. In addition, 5-FU-resistant cells exhibited higher glucose metabolic activity than 5-FU-sensitive cells, and miR-125 was identified to downregulate glucose metabolism by directly targeting Hk II. These results identified miR-125b as a tumor suppressor-like microRNA, which has great potential as a diagnostic and prognostic biomarker.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [17]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: MDA-MB-435 cells; Breast; Homo sapiens (Human); CVCL_0417
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Celltiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: miR-125b was up-regulated in Taxol-resistant cells, causing a marked inhibition of Taxol-induced cytotoxicity and apoptosis and a subsequent increase in the resistance to Taxol in cancer cells. The pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) is a direct target of miR-125b. Down-regulation of Bak1 suppressed Taxol-induced apoptosis and led to an increased resistance to Taxol.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [18]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: BALB/C nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR-125a/b significantly inhibited ALDH1A3 and Mcl1 expression, reduced cell survival, and increased cell apoptosis in HT29-taxol cells. Chemoresistance to paclitaxel is initiated by the downregulation of miR-125a/b expression, which subsequently upregulates ALDH1A3 and Mcl1 expression to promote survival of CSCs.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung cancer [19]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-125b was significantly downregulated in A549-PR and H460-PR cells. Notably, ectopic expression of miR-125b led to the reversal of EMT phenotype. Moreover, we found that miR-125b governed PR-induced EMT partly due to down-regulation of its target Sema4C. More importantly, overexpression of miR-125b or depletion of Sema4C sensitized PR cells to paclitaxel. Furthermore, stable overexpression miR-125b in A549-PR cells inhibited tumor xenograft growth in immunodeficient mice. Our study implied that up-regulation of miR-125b could be a novel approach to reverse chemotherapy resistance in lung cancers.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [20]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: NF-kappaB signaling pathway; Inhibition; hsa04064
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: LN-18 cells; Brain; Homo sapiens (Human); CVCL_0392
• In Vitro Model: T98G cells; Brain; Homo sapiens (Human); CVCL_0556
• In Vitro Model: U87-MG cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vitro Model: HS683 cells; Brain; Homo sapiens (Human); CVCL_0844
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Promega assay
• Mechanism Description: A novel mechanism independent of TP53 and MGMT by which oncogenic miR-125b confers TMZ resistance by targeting TNFAIP3 and NkIRAS2. GBM cells overexpressing miR-125b showed increased NF-kB activity and upregulation of anti-apoptotic and cell cycle genes. This was significantly associated with resistance of GBM cells to TNFalpha- and TNF-related inducing ligand-induced apoptosis as well as resistance to TMZ. Conversely, overexpression of anti-miR-125b resulted in cell cycle arrest, increased apoptosis and increased sensitivity to TMZ, indicating that endogenous miR-125b is sufficient to control these processes. GBM cells overexpressing TNFAIP3 and NkIRAS2 were refractory to miR-125b-induced apoptosis resistance as well as TMZ resistance, indicating that both genes are relevant targets of miR-125b.

Disease Class: Glioblastoma [21]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: GSCs cells; Brain; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: PCR
• Experiment for Drug Resistance: Transwell invasion assay
• Mechanism Description: Inhibition of miR-125b expression may enhance sensitivity of GSCs to temozolomide by targeting PIAS3 on cell invasion.

Trastuzumab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [22]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Trastuzumab
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: miR125b/HER2/Snail1 signaling pathway; Regulation; hsa05206
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Wound-healing assay; Transwell assay
• Mechanism Description: TINCR, which is transcriptionally activated by H3k27 acetylation, upregulates HER-2 expression by downregulating miR-125b and TINCR promotes trastuzumab resistance-induced EMT by directly targeting Snail-1.

Vemurafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [23]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Vemurafenib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: PLX4032-resistant cells; Skin; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: Western blot analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: CCL2 and miR-125b, miR-34a and miR-100 are potential targets for overcoming the miR-34a and miR-100 are potential targets for overcoming the resistance to BRAFi in melanoma.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [24]

• Resistant Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: ETV6-RUNX1-positive Reh cells; Blood; Homo sapiens (Human); CVCL_1650
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-125b (miR-125b), miR-99a and miR-100 are overexpressed in vincristine-resistant acute lymphoblastic leukemia (ALL).

Disease Class: Ewing sarcoma [11]

• Resistant Disease: Ewing sarcoma [ICD-11: 2B52.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: miR125b-p53/BAKT signaling pathway; Activation; hsa05206
• In Vitro Model: RD-ES cells; Bones; Homo sapiens (Human); CVCL_2169
• In Vitro Model: Sk-ES cells; Bones; Homo sapiens (Human); CVCL_0627
• In Vitro Model: Sk-N-MC cells; Bones; Homo sapiens (Human); CVCL_0530
• In Vitro Model: TC-71 cells; Bones; Homo sapiens (Human); CVCL_2213
• In Vitro Model: VH-64 cells; Bones; Homo sapiens (Human); CVCL_9672
• In Vitro Model: WE-68 cells; Bones; Homo sapiens (Human); CVCL_9717
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Celltiter-glo luminescent cell viability assay
• Mechanism Description: miR-125b led to the development of chemoresistance by suppressing the expression of p53 and Bak, and repression of miR-125b sensitized EWS cells to apoptosis induced by treatment with various cytotoxic drugs.

Disease Class: Primitive neuroectodermal tumor [11]

• Resistant Disease: Primitive neuroectodermal tumor [ICD-11: 2A00.08]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: miR125b-p53/BAKT signaling pathway; Activation; hsa05206
• In Vitro Model: RD-ES cells; Bones; Homo sapiens (Human); CVCL_2169
• In Vitro Model: Sk-ES cells; Bones; Homo sapiens (Human); CVCL_0627
• In Vitro Model: Sk-N-MC cells; Bones; Homo sapiens (Human); CVCL_0530
• In Vitro Model: TC-71 cells; Bones; Homo sapiens (Human); CVCL_2213
• In Vitro Model: VH-64 cells; Bones; Homo sapiens (Human); CVCL_9672
• In Vitro Model: WE-68 cells; Bones; Homo sapiens (Human); CVCL_9717
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Celltiter-glo luminescent cell viability assay
• Mechanism Description: miR-125b led to the development of chemoresistance by suppressing the expression of p53 and Bak, and repression of miR-125b sensitized EWS cells to apoptosis induced by treatment with various cytotoxic drugs.

References

• Ref 1: lncRNA MIR100HG-derived miR-100 and miR-125b mediate cetuximab resistance via Wnt/Beta-catenin signaling. Nat Med. 2017 Nov;23(11):1331-1341. doi: 10.1038/nm.4424. Epub 2017 Oct 16.
• Ref 2: Has miR 125a and 125b are induced by treatment with cisplatin in nasopharyngeal carcinoma and inhibit apoptosis in a p53 dependent manner by targeting p53 mRNA. Mol Med Rep. 2015 Sep;12(3):3569-3574. doi: 10.3892/mmr.2015.3863. Epub 2015 May 27.
• Ref 3: miR-125b confers resistance of ovarian cancer cells to cisplatin by targeting pro-apoptotic Bcl-2 antagonist killer 1. J Huazhong Univ Sci Technolog Med Sci. 2011 Aug;31(4):543. doi: 10.1007/s11596-011-0487-z. Epub 2011 Aug 7.
• Ref 4: microRNA-125b reverses the multidrug resistance of nasopharyngeal carcinoma cells via targeting of Bcl-2. Mol Med Rep. 2017 Apr;15(4):2223-2228. doi: 10.3892/mmr.2017.6233. Epub 2017 Feb 22.
• Ref 5: The functional mechanism of miR-125b in gastric cancer and its effect on the chemosensitivity of cisplatin. Oncotarget. 2017 Dec 14;9(2):2105-2119. doi: 10.18632/oncotarget.23249. eCollection 2018 Jan 5.
• Ref 6: MiR-125b Functions as a Tumor Suppressor and Enhances Chemosensitivity to Cisplatin in Osteosarcoma. Technol Cancer Res Treat. 2016 Dec;15(6):NP105-NP112. doi: 10.1177/1533034615618849. Epub 2016 Jan 6.
• Ref 7: Circulating MiR-125b as a marker predicting chemoresistance in breast cancer. PLoS One. 2012;7(4):e34210. doi: 10.1371/journal.pone.0034210. Epub 2012 Apr 16.
• Ref 8: miR-125b regulates side population in breast cancer and confers a chemoresistant phenotype. J Cell Biochem. 2013 Oct;114(10):2248-57. doi: 10.1002/jcb.24574.
• Ref 9: microRNA 125b promotes leukemia cell resistance to daunorubicin by inhibiting apoptosis. Mol Med Rep. 2014 May;9(5):1909-16. doi: 10.3892/mmr.2014.2011. Epub 2014 Mar 6.
• Ref 10: miRNA expression patterns in chemoresistant breast cancer tissues. Biomed Pharmacother. 2014 Oct;68(8):935-42. doi: 10.1016/j.biopha.2014.09.011. Epub 2014 Oct 5.
• Ref 11: miR-125b develops chemoresistance in Ewing sarcoma/primitive neuroectodermal tumor. Cancer Cell Int. 2013 Mar 4;13(1):21. doi: 10.1186/1475-2867-13-21.
• Ref 12: Upregulation of microRNA-125b contributes to leukemogenesis and increases drug resistance in pediatric acute promyelocytic leukemia. Mol Cancer. 2011 Sep 1;10:108. doi: 10.1186/1476-4598-10-108.
• Ref 13: miR-125b regulates the drug-resistance of breast cancer cells to doxorubicin by targeting HAX-1. Oncol Lett. 2018 Feb;15(2):1621-1629. doi: 10.3892/ol.2017.7476. Epub 2017 Nov 23.
• Ref 14: miR-125b acts as a tumor suppressor in chondrosarcoma cells by the sensitization to doxorubicin through direct targeting the ErbB2-regulated glucose metabolism. Drug Des Devel Ther. 2016 Feb 24;10:571-83. doi: 10.2147/DDDT.S90530. eCollection 2016.
• Ref 15: CXCL12/CXCR4 axis induced miR-125b promotes invasion and confers 5-fluorouracil resistance through enhancing autophagy in colorectal cancer. Sci Rep. 2017 Feb 8;7:42226. doi: 10.1038/srep42226.
• Ref 16: Overexpression of microRNA-125b sensitizes human hepatocellular carcinoma cells to 5-fluorouracil through inhibition of glycolysis by targeting hexokinase II. Mol Med Rep. 2014 Aug;10(2):995-1002. doi: 10.3892/mmr.2014.2271. Epub 2014 May 26.
• Ref 17: MicroRNA-125b confers the resistance of breast cancer cells to paclitaxel through suppression of pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) expression. J Biol Chem. 2010 Jul 9;285(28):21496-507. doi: 10.1074/jbc.M109.083337. Epub 2010 May 11.
• Ref 18: MiR-125a/b regulates the activation of cancer stem cells in paclitaxel-resistant colon cancer. Cancer Invest. 2013 Jan;31(1):17-23. doi: 10.3109/07357907.2012.743557.
• Ref 19: Up-regulation of miR-125b reverses epithelial-mesenchymal transition in paclitaxel-resistant lung cancer cells. Biol Chem. 2015 Aug 20:/j/bchm.just-accepted/hsz-2015-0153/hsz-2015-0153.xml. doi: 10.1515/hsz-2015-0153. Online ahead of print.
• Ref 20: miR-125b controls apoptosis and temozolomide resistance by targeting TNFAIP3 and NKIRAS2 in glioblastomas. Cell Death Dis. 2014 Jun 5;5(6):e1279. doi: 10.1038/cddis.2014.245.
• Ref 21: miR-125b inhibitor may enhance the invasion-prevention activity of temozolomide in glioblastoma stem cells by targeting PIAS3. BioDrugs. 2014 Feb;28(1):41-54. doi: 10.1007/s40259-013-0053-2.
• Ref 22: Activation of LncRNA TINCR by H3K27 acetylation promotes Trastuzumab resistance and epithelial-mesenchymal transition by targeting MicroRNA-125b in breast Cancer. Mol Cancer. 2019 Jan 8;18(1):3. doi: 10.1186/s12943-018-0931-9.
• Ref 23: Overcoming melanoma resistance to vemurafenib by targeting CCL2-induced miR-34a, miR-100 and miR-125b. Oncotarget. 2016 Jan 26;7(4):4428-41. doi: 10.18632/oncotarget.6599.
• Ref 24: MiR-125b, miR-100 and miR-99a co-regulate vincristine resistance in childhood acute lymphoblastic leukemia. Leuk Res. 2013 Oct;37(10):1315-21. doi: 10.1016/j.leukres.2013.06.027. Epub 2013 Jul 31.