Molecule Information

General Information of the Molecule (ID: Mol01415)

• Name: hsa-mir-124 ,Homo sapiens
• Synonyms: microRNA 124-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR124-1
• Gene ID: 406907
• Location: chr8:9903388-9903472[-]
• Sequence:
  AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCAC
  GCGGUGAAUGCCAAGAAUGGGGCUG
• Ensembl ID: ENSG00000284321
• HGNC ID: HGNC:31502
• Precursor Accession: MI0000443

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Dexamethasone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [1]

• Resistant Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Resistant Drug: Dexamethasone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: Jurkat cells; Pleural effusion; Homo sapiens (Human); CVCL_0065
• In Vitro Model: CCRF-CEM cells; Pleural effusion; Homo sapiens (Human); CVCL_0207
• In Vitro Model: CEM/C1 cells; Peripheral blood; Homo sapiens (Human); CVCL_3496
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: miR124 contributes to glucocorticoid resistance in acute lymphoblastic leukemia by promoting proliferation, inhibiting apoptosis and targeting NR3C1.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: STAT3/HIF-1 signaling pathway; Inhibition; hsa04066
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-124 sensitizes DOX-resistant BCSCs to DOX by modulating the STAT3 and HIF-1 signaling pathways.

Disease Class: Osteosarcoma [3]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance.

Disease Class: Breast cancer [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance.

Erlotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [4]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: Capan-1 cells; Pancreas; Homo sapiens (Human); CVCL_0237
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-124 overexpression was able to sensitize the response of Capan-1 cells to erlotinib through inhibiting EphA2.

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [3]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance.

Disease Class: Breast cancer [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [5]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Annexin V-FITC Apoptosis assay
• Mechanism Description: miR124 decreased SNAI2 and STAT3 expression by directly targeting their 3'UTRs, miR124 contributes to gefitinib and EMT by directly targeting SNAI2 and STAT3. Over-expression of miR124 re-sensitized gefitinib-resistant cell lines to gefitinib.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [6]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: LN229 cells; Brain; Homo sapiens (Human); CVCL_0393
• In Vitro Model: A172 cells; Brain; Homo sapiens (Human); CVCL_0131
• In Vitro Model: T98G cells; Brain; Homo sapiens (Human); CVCL_0556
• In Vitro Model: M059J cells; Brain; Homo sapiens (Human); CVCL_0400
• In Vitro Model: M059k cells; Brain; Homo sapiens (Human); CVCL_0401
• In Vitro Model: U-87 MG cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vitro Model: U118 MG cells; Brain; Homo sapiens (Human); CVCL_0633
• In Vitro Model: U138-MG cells; Brain; Homo sapiens (Human); CVCL_0020
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR124 suppresses glioblastoma growth and potentiates chemosensitivity by inhibiting AURkA. Re-expression of AURkA rescued miR124-mediated growth suppression.

Clinical Trial Drug(s) 1 drug(s) in total

Camptothecin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [3]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Camptothecin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance.

Disease Class: Breast cancer [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Camptothecin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance.

Investigative Drug(s) 1 drug(s) in total

Iridium

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [3]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Iridium
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance.

Disease Class: Breast cancer [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Iridium
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: HCC1937 cells; Breast; Homo sapiens (Human); CVCL_0290
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance.

References

• Ref 1: MiR-124 contributes to glucocorticoid resistance in acute lymphoblastic leukemia by promoting proliferation, inhibiting apoptosis and targeting the glucocorticoid receptor. J Steroid Biochem Mol Biol. 2017 Sep;172:62-68. doi: 10.1016/j.jsbmb.2017.05.014. Epub 2017 May 31.
• Ref 2: MiR-124 reversed the doxorubicin resistance of breast cancer stem cells through STAT3/HIF-1 signaling pathways. Cell Cycle. 2019 Sep;18(18):2215-2227. doi: 10.1080/15384101.2019.1638182. Epub 2019 Jul 29.
• Ref 3: The Effect of MicroRNA-124 Overexpression on Anti-Tumor Drug Sensitivity. PLoS One. 2015 Jun 26;10(6):e0128472. doi: 10.1371/journal.pone.0128472. eCollection 2015.
• Ref 4: Targeting EphA2 with miR-124 mediates Erlotinib resistance in K-RAS mutated pancreatic cancer. J Pharm Pharmacol. 2019 Feb;71(2):196-205. doi: 10.1111/jphp.12941. Epub 2019 Jan 2.
• Ref 5: miR-124 modulates gefitinib resistance through SNAI2 and STAT3 in non-small cell lung cancer. J Huazhong Univ Sci Technolog Med Sci. 2016 Dec;36(6):839-845. doi: 10.1007/s11596-016-1672-x. Epub 2016 Dec 7.
• Ref 6: miR-124 suppresses glioblastoma growth and potentiates chemosensitivity by inhibiting AURKA. Biochem Biophys Res Commun. 2017 Apr 22;486(1):43-48. doi: 10.1016/j.bbrc.2017.02.120. Epub 2017 Feb 24.