Molecule Information

General Information of the Molecule (ID: Mol01405)

• Name: hsa-mir-223 ,Homo sapiens
• Synonyms: microRNA 223
• Molecule Type: Precursor miRNA
• Gene Name: MIR223
• Gene ID: 407008
• Location: chrX:66018870-66018979[+]
• Sequence:
  CCUGGCCUCCUGCAGUGCCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCCAUGU
  GGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGCGGCACAUGCUUACCAG
• Ensembl ID: ENSG00000284567
• HGNC ID: HGNC:31603
• Precursor Accession: MI0000300

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 9 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: IGF1R/AKT/PI3K signaling pathway; Activation; hsa05224
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: NCI-H292 cells; Lung; Homo sapiens (Human); CVCL_0455
• In Vitro Model: NCI-H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: NCI-H838 cells; Lung; Homo sapiens (Human); CVCL_1594
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Long non-coding RNA EGFR-AS1 Can enhance IGF1R expression by suppressing miR-223 expression to promotes cisplatin resistance in the non-small cell lung cancer.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• In Vitro Model: MDA-MB-435 cells; Breast; Homo sapiens (Human); CVCL_0417
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; FITC-Annexin V and PI staining assay; Flow cytometry assay
• Mechanism Description: microRNA-223 increases the sensitivity of triple-negative breast cancer stem cells to TRAIL-induced apoptosis by targeting HAX-1.

Disease Class: Osteosarcoma [3]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: JNk signaling pathway; Activation; hsa04010
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: SJSA-1 cells; Bone; Homo sapiens (Human); CVCL_1697
• In Vitro Model: HOS cells; Bone; Homo sapiens (Human); CVCL_0312
• In Vitro Model: Sk-ES-1 cells; Bone; Homo sapiens (Human); CVCL_0627
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-223 overexpression could sensitize OS cell lines to CDDP and Hsp70 protein levels were remarkably reduced by miR-223 overexpression whereas increased by miR-223 inhibition.

Disease Class: Esophageal adenocarcinoma [4]

• Sensitive Disease: Esophageal adenocarcinoma [ICD-11: 2B70.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: OE33 cellss; Esophagus; Homo sapiens (Human); CVCL_0471
• In Vitro Model: HEEpiC cells; Esophagus; Homo sapiens (Human); N.A.
• In Vitro Model: JHesoAD1 cells; Esophagus; Homo sapiens (Human); CVCL_8098
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: The DNA damage repair protein poly(ADP-ribose) polymerase 1 (PARP1) is a bona fide target of miR-223, miR-223 up-regulation is also associated with reduced PARP1 transcripts, and an increased sensitivity to cis-diamminedichloroplatinum (II) (Cisplatin), Doxorubicin and Mitomycin C.

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gallbladder cancer [5]

• Sensitive Disease: Gallbladder cancer [ICD-11: 2C13.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: GBC-SD cells; Gallbladder; Homo sapiens (Human); CVCL_6903
• In Vitro Model: NOZ cells; Gallbladder; Homo sapiens (Human); CVCL_3079
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR223 increases gallbladder cancer cell sensitivity to docetaxel by downregulating STMN1.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• In Vitro Model: MDA-MB-435 cells; Breast; Homo sapiens (Human); CVCL_0417
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; FITC-Annexin V and PI staining assay; Flow cytometry assay
• Mechanism Description: microRNA-223 increases the sensitivity of triple-negative breast cancer stem cells to TRAIL-induced apoptosis by targeting HAX-1.

Disease Class: Breast cancer [6]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell Death assay
• Mechanism Description: miR-223 Impairs Tumor Cell Migration and Invasion, miR-223 Expression Enhances Cell Death in Anoikis Conditions or in Presence of Chemotherapeutic Drugs (Doxorubicin and Paclitaxel), miR-223 Affects Signal Transduction Pathways Involved in Cell Death and Directly Targets STAT5A, Down-modulation of STAT5A Accounts for miR-223 Biological Effects.

Disease Class: Hepatocellular carcinoma [7]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: Skhep1 cells; Liver; Homo sapiens (Human); CVCL_0525
• In Vitro Model: HCC3 cells; Liver; Homo sapiens (Human); CVCL_0C57
• In Vitro Model: LM-6 cells; Liver; Homo sapiens (Human); CVCL_7680
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-223 targeted ABCB1 3'UTR directly, and miR-223 down-regulated ABCB1 at both mRNA and protein levels. The over-expression of miR-223 increased the HCC cellsensitivity to anticancer drugs, and the inhibition of miR-223 had the opposite effect. Importantly, the over-expression or silencingof ABCB1 can rescue the cell response to the anticancer drugs mediated by miR-223 over-expression or inhibition.

Disease Class: Esophageal adenocarcinoma [4]

• Sensitive Disease: Esophageal adenocarcinoma [ICD-11: 2B70.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: OE33 cellss; Esophagus; Homo sapiens (Human); CVCL_0471
• In Vitro Model: HEEpiC cells; Esophagus; Homo sapiens (Human); N.A.
• In Vitro Model: JHesoAD1 cells; Esophagus; Homo sapiens (Human); CVCL_8098
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: The DNA damage repair protein poly(ADP-ribose) polymerase 1 (PARP1) is a bona fide target of miR-223, miR-223 up-regulation is also associated with reduced PARP1 transcripts, and an increased sensitivity to cis-diamminedichloroplatinum (II) (Cisplatin), Doxorubicin and Mitomycin C.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Colorectal cancer [8]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: miR223/FBXW7 signaling pathway; Regulation; hsa05206
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Overexpression of miR-223 decreased FBXW7 expression and the sensitivity of CRC cells to doxorubicin, while suppression of miR-223 had the opposite effect.

Erlotinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [9]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Notch/miR223/FBXW7 signaling pathway; Regulation; hsa04330
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• In Vitro Model: HCC827/ER cells; Lung; Homo sapiens (Human); CVCL_EJ07
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay
• Mechanism Description: Sensitivity of non-small cell lung cancer to erlotinib is regulated by the Notch/miR223/FBXW7 pathway. Blocking either the Akt or Notch signaling pathway and reducing miR223 expression resulted in decreased resistance in HCC827/ER cells, miR223 enhanced resistance to erlotinib by down-regulating FBXW7 expression.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [10]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: IGF-1R/AKT/S6 signaling pathway; Regulation; hsa05226
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-223 inhibits IGF-1R/Akt/S6 signaling, and this effect is reversed by the exogenous expression of IGF-1. Overexpression of miR-223 enhances the sensitivity of PC-9/ER cells to erlotinib by inducing apoptosis.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: IGF1R/AKT/PI3K signaling pathway; Activation; hsa05224
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: NCI-H292 cells; Lung; Homo sapiens (Human); CVCL_0455
• In Vitro Model: NCI-H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: NCI-H838 cells; Lung; Homo sapiens (Human); CVCL_1594
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Long non-coding RNA EGFR-AS1 Can enhance IGF1R expression by suppressing miR-223 expression to promotes gemcitabine resistance in the non-small cell lung cancer.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [11]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Transwell migration and invasion assay
• Mechanism Description: Down-regulation of miR-223 reverses epithelial-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells due to down-regulation of its target Fbw7 and subsequent upregulation of Notch-1, which enhances GR cells to gemcitabine sensitivity.

Mitomycin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal adenocarcinoma [4]

• Sensitive Disease: Esophageal adenocarcinoma [ICD-11: 2B70.2]
• Sensitive Drug: Mitomycin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: OE33 cellss; Esophagus; Homo sapiens (Human); CVCL_0471
• In Vitro Model: HEEpiC cells; Esophagus; Homo sapiens (Human); N.A.
• In Vitro Model: JHesoAD1 cells; Esophagus; Homo sapiens (Human); CVCL_8098
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: The DNA damage repair protein poly(ADP-ribose) polymerase 1 (PARP1) is a bona fide target of miR-223, miR-223 up-regulation is also associated with reduced PARP1 transcripts, and an increased sensitivity to cis-diamminedichloroplatinum (II) (Cisplatin), Doxorubicin and Mitomycin C.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [6]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell Death assay
• Mechanism Description: miR-223 Impairs Tumor Cell Migration and Invasion, miR-223 Expression Enhances Cell Death in Anoikis Conditions or in Presence of Chemotherapeutic Drugs (Doxorubicin and Paclitaxel), miR-223 Affects Signal Transduction Pathways Involved in Cell Death and Directly Targets STAT5A, Down-modulation of STAT5A Accounts for miR-223 Biological Effects.

Disease Class: Hepatocellular carcinoma [7]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: Skhep1 cells; Liver; Homo sapiens (Human); CVCL_0525
• In Vitro Model: HCC3 cells; Liver; Homo sapiens (Human); CVCL_0C57
• In Vitro Model: LM-6 cells; Liver; Homo sapiens (Human); CVCL_7680
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-223 targeted ABCB1 3'UTR directly, and miR-223 down-regulated ABCB1 at both mRNA and protein levels. The over-expression of miR-223 increased the HCC cellsensitivity to anticancer drugs, and the inhibition of miR-223 had the opposite effect. Importantly, the over-expression or silencingof ABCB1 can rescue the cell response to the anticancer drugs mediated by miR-223 over-expression or inhibition.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [12]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Transwell assay; Transwell matrix penetration assay; MTT assay; BrdU incorporation assay
• Mechanism Description: miR223/PAX6 axis regulates glioblastoma stem cell proliferation and the chemo resistance to TMZ via inhibition of PI3k/Akt pathway.

Trastuzumab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [13]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Trastuzumab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: miR223/FBXW7 signaling pathway; Regulation; hsa05206
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vitro Model: KATO-3 cells; Gastric; Homo sapiens (Human); CVCL_0371
• In Vitro Model: NUGC3 cells; Gastric; Homo sapiens (Human); CVCL_1612
• In Vitro Model: NUGC4 cells; Gastric; Homo sapiens (Human); CVCL_3082
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Overexpression of miR-223 decreased FBXW7 expression and the sensitivity of GC cells to trastuzumab, while suppression of miR-223 restored FBXW7 expression and the sensitivity of GC cells to trastuzumab.

Investigative Drug(s) 2 drug(s) in total

Dapt (Gsi IX)

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute T-cell lymphocytic leukemia [14]

• Resistant Disease: Acute T-cell lymphocytic leukemia [ICD-11: 2A90.5]
• Resistant Drug: Dapt (Gsi IX)
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Notch/NF-kB signaling pathway; Regulation; hsa04330
• In Vitro Model: Jurkat cells; Pleural effusion; Homo sapiens (Human); CVCL_0065
• In Vitro Model: DND41 cells; Pleural effusion; Homo sapiens (Human); CVCL_2022
• In Vitro Model: Jurkat IkkGamma -/- cells; Pleural effusion; Homo sapiens (Human); CVCL_0065
• In Vitro Model: Molt3 cells; Pleural effusion; Homo sapiens (Human); CVCL_0624
• In Vitro Model: TALL-1 cells; Pleural effusion; Homo sapiens (Human); CVCL_1736
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Trypan blue staining; MTT assay; Promega assay
• Mechanism Description: Specific inhibition of miR-223 restores GSI sensitivity in GSI-resistant Molt3 cells carrying wt FBXW7. Therefore, upregulation of FBXW7 through the specific inhibition of miR-223 could offer an attractive targeted therapy for GSI-resistant T-ALLs harboring wt FBXW7 and overexpressing miR-223.

Platinum

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Epithelial ovarian cancer [15]

• Resistant Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Resistant Drug: Platinum
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Hypoxic TAMs derived exosomes containing miR-223 were internalized by EOC cells and promoted drug resistance of EOC cells and exosmic miR-223 inactivate PI3k/AkT pathway through PTEN targeting.

References

• Ref 1: Overexpression of lncRNA EGFR AS1 is associated with a poor prognosis and promotes chemotherapy resistance in non small cell lung cancer. Int J Oncol. 2019 Jan;54(1):295-305. doi: 10.3892/ijo.2018.4629. Epub 2018 Nov 9.
• Ref 2: MicroRNA-223 Increases the Sensitivity of Triple-Negative Breast Cancer Stem Cells to TRAIL-Induced Apoptosis by Targeting HAX-1. PLoS One. 2016 Sep 12;11(9):e0162754. doi: 10.1371/journal.pone.0162754. eCollection 2016.
• Ref 3: miR-223/Hsp70/JNK/JUN/miR-223 feedback loop modulates the chemoresistance of osteosarcoma to cisplatin. Biochem Biophys Res Commun. 2018 Mar 11;497(3):827-834. doi: 10.1016/j.bbrc.2018.02.091. Epub 2018 Feb 9.
• Ref 4: MicroRNA 223 is upregulated in the multistep progression of Barrett's esophagus and modulates sensitivity to chemotherapy by targeting PARP1. Clin Cancer Res. 2013 Aug 1;19(15):4067-78. doi: 10.1158/1078-0432.CCR-13-0601. Epub 2013 Jun 11.
• Ref 5: miR-223 increases gallbladder cancer cell sensitivity to docetaxel by downregulating STMN1. Oncotarget. 2016 Sep 20;7(38):62364-62376. doi: 10.18632/oncotarget.11634.
• Ref 6: miR-223 is a coordinator of breast cancer progression as revealed by bioinformatics predictions. PLoS One. 2014 Jan 6;9(1):e84859. doi: 10.1371/journal.pone.0084859. eCollection 2014.
• Ref 7: MiR-223 modulates multidrug resistance via downregulation of ABCB1 in hepatocellular carcinoma cells. Exp Biol Med (Maywood). 2013 Sep;238(9):1024-32. doi: 10.1177/1535370213497321. Epub 2013 Aug 7.
• Ref 8: MiR-223 promotes the doxorubicin resistance of colorectal cancer cells via regulating epithelial-mesenchymal transition by targeting FBXW7. Acta Biochim Biophys Sin (Shanghai). 2018 Jun 1;50(6):597-604. doi: 10.1093/abbs/gmy040.
• Ref 9: Sensitivity of non-small cell lung cancer to erlotinib is regulated by the Notch/miR-223/FBXW7 pathway. Biosci Rep. 2017 Jun 21;37(3):BSR20160478. doi: 10.1042/BSR20160478. Print 2017 Jun 30.
• Ref 10: miR-223 enhances the sensitivity of non-small cell lung cancer cells to erlotinib by targeting the insulin-like growth factor-1 receptor. Int J Mol Med. 2016 Jul;38(1):183-91. doi: 10.3892/ijmm.2016.2588. Epub 2016 May 13.
• Ref 11: Down-regulation of miR-223 reverses epithelial-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Oncotarget. 2015 Jan 30;6(3):1740-9. doi: 10.18632/oncotarget.2714.
• Ref 12: MiR-223/PAX6 Axis Regulates Glioblastoma Stem Cell Proliferation and the Chemo Resistance to TMZ via Regulating PI3K/Akt Pathway. J Cell Biochem. 2017 Oct;118(10):3452-3461. doi: 10.1002/jcb.26003. Epub 2017 Jun 6.
• Ref 13: The sensitivity of gastric cancer to trastuzumab is regulated by the miR-223/FBXW7 pathway. Int J Cancer. 2015 Apr 1;136(7):1537-45. doi: 10.1002/ijc.29168. Epub 2014 Sep 11.
• Ref 14: Notch and NF-kB signaling pathways regulate miR-223/FBXW7 axis in T-cell acute lymphoblastic leukemia. Leukemia. 2014 Dec;28(12):2324-35. doi: 10.1038/leu.2014.133. Epub 2014 Apr 14.
• Ref 15: Macrophages derived exosomes deliver miR-223 to epithelial ovarian cancer cells to elicit a chemoresistant phenotype. J Exp Clin Cancer Res. 2019 Feb 15;38(1):81. doi: 10.1186/s13046-019-1095-1.