Molecule Information

General Information of the Molecule (ID: Mol01392)
Name
hsa-mir-204 ,Homo sapiens
Synonyms
microRNA 204
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR204
Gene ID
406987
Location
chr9:70809975-70810084[-]
Sequence
GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAU
AUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC
    Click to Show/Hide
Ensembl ID
ENSG00000207935
HGNC ID
HGNC:31582
Precursor Accession
MI0000284
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Click to Show/Hide the Full List of Drugs
Arsenic trioxide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute myeloid leukemia [1]
Sensitive Disease Acute myeloid leukemia [ICD-11: 2A60.0]
 Disease Info 
Sensitive Drug Arsenic trioxide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cancer progression Inhibition hsa05200
In Vitro Model AML-5 cells Peripheral blood Homo sapiens (Human) CVCL_1620
HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description miR-204 decreases ATO chemoresistance in AML cells at least partially via promoting BIRC6/p53-mediated apoptosis.
Cetuximab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [2]
Sensitive Disease Head and neck squamous cell carcinoma [ICD-11: 2D42.1]
 Disease Info 
Sensitive Drug Cetuximab
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation JAKT2/STAT3 signaling pathway Inhibition hsa04030
In Vitro Model 5-8F cells Nasopharynx Homo sapiens (Human) CVCL_C528
CNE2 cells Nasopharynx Homo sapiens (Human) CVCL_6889
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR204 inhibits angiogenesis and promotes sensitivity to cetuximab in head and neck squamous cell carcinoma cells by blocking JAk2-STAT3 signaling.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [3]
Resistant Disease Glioma [ICD-11: 2A00.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
SNB19 cells Brain Homo sapiens (Human) CVCL_0535
U373 cells Brain Homo sapiens (Human) CVCL_2219
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Colony formation assays
Mechanism Description Knockdown of LncRNA HOXD-AS1 suppresses proliferation, migration and invasion and enhances cisplatin sensitivity of glioma cells by sponging miR-20.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [3]
Sensitive Disease Glioma [ICD-11: 2A00.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
SNB19 cells Brain Homo sapiens (Human) CVCL_0535
U373 cells Brain Homo sapiens (Human) CVCL_2219
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Colony formation assays
Mechanism Description miR-204 overexpression suppressed proliferation, migration and invasion and enhanced the DDP sensitivity in glioma cells.
Disease Class: Neuroblastoma [4]
Sensitive Disease Neuroblastoma [ICD-11: 2A00.11]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model Kelly cells Adrenal Homo sapiens (Human) CVCL_2092
Sk-N-AS cells Adrenal Homo sapiens (Human) CVCL_1700
SH-SY5Y cells Abdomen Homo sapiens (Human) CVCL_0019
In Vivo Model Orthotopic xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description miR-204 direct targeting of the 3' UTR of BCL2 and NTRk2 (TrkB). BCL2 has a critical role in ensuring the survival of early developing cell types, NTRk2 is also a well-established pro-survival oncogene in neuroblastoma, signalling the activation of the PI3k/AkT pathway, a significant mechanism of drug resistance in neuroblastoma. Ectopic miR-204 expression significantly increased sensitivity to cisplatin and etoposide in vitro.
Cyclophosphamide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [5]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Cyclophosphamide
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Activation hsa05200
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Low miR-024 expression was enhancing chemotherapeutic resistance of breast cancer patients.
Docetaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [6]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Sensitive Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation UCA1/miR204/Sirt1 signaling pathway Activation hsa05206
In Vitro Model LNCaP cells Prostate Homo sapiens (Human) CVCL_0395
22RV1 cells Prostate Homo sapiens (Human) CVCL_1045
PNT2 cells Prostate Homo sapiens (Human) CVCL_2164
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Annexin V-FITC Apoptosis assay; Flow cytometer
Mechanism Description The UCA1/miR204/Sirt1 axis modulates docetaxel sensitivity of prostate cancer cells. UCA1 upregulation directly resulted in decreased miR204 expression.
Epirubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [5]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Epirubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Activation hsa05200
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Low miR-024 expression was enhancing chemotherapeutic resistance of breast cancer patients.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Neuroblastoma [4]
Sensitive Disease Neuroblastoma [ICD-11: 2A00.11]
 Disease Info 
Sensitive Drug Etoposide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model Kelly cells Adrenal Homo sapiens (Human) CVCL_2092
Sk-N-AS cells Adrenal Homo sapiens (Human) CVCL_1700
SH-SY5Y cells Abdomen Homo sapiens (Human) CVCL_0019
In Vivo Model Orthotopic xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description miR-204 direct targeting of the 3' UTR of BCL2 and NTRk2 (TrkB). BCL2 has a critical role in ensuring the survival of early developing cell types, NTRk2 is also a well-established pro-survival oncogene in neuroblastoma, signalling the activation of the PI3k/AkT pathway, a significant mechanism of drug resistance in neuroblastoma. Ectopic miR-204 expression significantly increased sensitivity to cisplatin and etoposide in vitro.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [5]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Activation hsa05200
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Low miR-024 expression was enhancing chemotherapeutic resistance of breast cancer patients.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [7]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model NCI-N87 cells Gastric Homo sapiens (Human) CVCL_1603
GTL-16 cells Gastric Homo sapiens (Human) CVCL_7668
In Vivo Model CD1 nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR-204 targeted Bcl-2 messenger RNA and increased responsiveness of GC cells to 5-fluorouracil and oxaliplatin treatment. Ectopic expression of Bcl-2 protein counteracted miR-204 pro-apoptotic activity in response to 5-fluorouracil.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Gastric cancer [8]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Cell viability Inhibition hsa05200
TGF-beta signaling pathway Inhibition hsa04350
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
AGS cells Gastric Homo sapiens (Human) CVCL_0139
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Caspase 3 assay kit
Mechanism Description Sensitization of Gastric Cancer Cells to 5-FU by microRNA-204 Through Targeting the TGFBR2-Mediated Epithelial to Mesenchymal Transition.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [7]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model NCI-N87 cells Gastric Homo sapiens (Human) CVCL_1603
GTL-16 cells Gastric Homo sapiens (Human) CVCL_7668
In Vivo Model CD1 nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description miR-204 targeted Bcl-2 messenger RNA and increased responsiveness of GC cells to 5-fluorouracil and oxaliplatin treatment. Ectopic expression of Bcl-2 protein counteracted miR-204 pro-apoptotic activity in response to 5-fluorouracil.
References
Ref 1 MicroRNA-204 Potentiates the Sensitivity of Acute Myeloid Leukemia Cells to Arsenic Trioxide. Oncol Res. 2019 Sep 23;27(9):1035-1042. doi: 10.3727/096504019X15528367532612. Epub 2019 Apr 8.
Ref 2 miR-204 inhibits angiogenesis and promotes sensitivity to cetuximab in head and neck squamous cell carcinoma cells by blocking JAK2-STAT3 signaling. Biomed Pharmacother. 2018 Mar;99:278-285. doi: 10.1016/j.biopha.2018.01.055.
Ref 3 Knockdown of lncRNA HOXD-AS1 suppresses proliferation, migration and invasion and enhances cisplatin sensitivity of glioma cells by sponging miR-204. Biomed Pharmacother. 2019 Apr;112:108633. doi: 10.1016/j.biopha.2019.108633. Epub 2019 Feb 20.
Ref 4 MicroRNA-204 increases sensitivity of neuroblastoma cells to cisplatin and is associated with a favourable clinical outcome. Br J Cancer. 2012 Sep 4;107(6):967-76. doi: 10.1038/bjc.2012.356. Epub 2012 Aug 14.
Ref 5 Decreased expression of miR-204 is associated with poor prognosis in patients with breast cancer. Int J Clin Exp Pathol. 2014 May 15;7(6):3287-92. eCollection 2014.
Ref 6 The UCA1/miR-204/Sirt1 axis modulates docetaxel sensitivity of prostate cancer cells. Cancer Chemother Pharmacol. 2016 Nov;78(5):1025-1031. doi: 10.1007/s00280-016-3158-8. Epub 2016 Sep 29.
Ref 7 miR-204 targets Bcl-2 expression and enhances responsiveness of gastric cancer. Cell Death Dis. 2012 Nov 15;3(11):e423. doi: 10.1038/cddis.2012.160.
Ref 8 Sensitization of Gastric Cancer Cells to 5-FU by MicroRNA-204 Through Targeting the TGFBR2-Mediated Epithelial to Mesenchymal Transition. Cell Physiol Biochem. 2018;47(4):1533-1545. doi: 10.1159/000490871. Epub 2018 Jun 21.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.