Molecule Information

General Information of the Molecule (ID: Mol01391)

• Name: hsa-mir-203 ,Homo sapiens
• Synonyms: microRNA 203a
• Molecule Type: Precursor miRNA
• Gene Name: MIR203A
• Gene ID: 406986
• Location: chr14:104117405-104117514[+]
• Sequence:
  GUGUUGGGGACUCGCGCGCUGGGUCCAGUGGUUCUUAACAGUUCAACAGUUCUGUAGCGC
  AAUUGUGAAAUGUUUAGGACCACUAGACCCGGCGGGCGCGGCGACAGCGA
• Ensembl ID: ENSG00000207568
• HGNC ID: HGNC:31581
• Precursor Accession: MI0000283

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: NHBE cells; Lung; Homo sapiens (Human); CVCL_S124
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Caspase 3/7 apoptosis assay
• Mechanism Description: Overexpression of miR203 increases the sensitivity of NSCLC A549/H460 cell lines to cisplatin by targeting Dickkopf-1.

Disease Class: Nasopharyngeal carcinoma [2]

• Sensitive Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: 5-8F cells; Nasopharynx; Homo sapiens (Human); CVCL_C528
• In Vitro Model: 6-10B cells; Nasopharynx; Homo sapiens (Human); CVCL_C529
• In Vitro Model: SUNE-1 cells; Nasopharynx; Homo sapiens (Human); CVCL_6946
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: There is a directly negative feedback loop between miR203 and ZEB2 participating in tumor stemness and chemotherapy resistance.

Disease Class: Tongue squamous cell carcinoma [3]

• Sensitive Disease: Tongue squamous cell carcinoma [ICD-11: 2B62.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PIk3CA signaling pathway; Regulation; hsa04211
• In Vitro Model: Tca8113 cells; Tongue; Homo sapiens (Human); CVCL_6851
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-203 expression is much lower in the clinical tongue cancer samples. In the surviving Tca8113 cells after cisplatin treatment, miR-203 expression was much lower. Delivery of miR-203 sensitized the Tca8113 cells to cisplatin induced cell death through downregulation of PIk3CA.

Disease Class: Bladder cancer [4]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: 5637 cells; Bladder; Homo sapiens (Human); CVCL_0126
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-203 could directly bind the 3'-UTR of both Bcl-w and Survivin, resulting in down-regulated expression of Bcl-w and Survivin at post-transcriptional level. miR-203 can be used as a predictor for progression and prognosis of BC patients treated with cisplatin based chemotherapy. Moreover, overexpression of miR-203 can enhance cisplatin sensitization by promoting apoptosis via directly targeting Bcl-w and Survivin.

Disease Class: Breast cancer [5]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: ZR-75 cells; Breast; Homo sapiens (Human); CVCL_0588
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Trypan blue dye exclusion assay
• Mechanism Description: Overexpression of SOCS3 could efficiently enhance cisplatin-mediated cell cytotoxicity in breast cancer cells. SOCS3 expression is significantly higher in miR-203 knockdown cisplatin-treated MCF-7 cells, thus cause the resistance to cisplatin.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung adenocarcinoma [6]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Epithelial mesenchymal transition signaling pathway; Inhibition; hsa01521
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Direct interaction between miR203 and ZEB2 suppresses epithelial-mesenchymal transition signaling and reduces lung adenocarcinoma chemoresistance. ZEB2 was found to be a direct target of miR203, which induces epithelial-mesenchymal transition (EMT) signal.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [7]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-453 cells; Breast; Homo sapiens (Human); CVCL_0418
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-200c and miR-203 overexpression in breast cancer cells downregulated Bmi1 expression accompanied with reversion of resistance to 5-Fu mediated by Bmi1.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Glioblastoma [8]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: SNAI2 is a direct target of miR-203 and that miR-203-mediated inhibition of SNAI2 is dependent on a conversed motif in the 3'-UTR of SNAI2. Recent independent studies have shown that overexpression of SNAI2 alters cell invasion, motility, chemoresistance, metastasis and poor prognosis in several human cancers. As a member of the snail family of transcription factors, SNAI2 can repress E-cadherin transcription and induce EMT directly. Therefore, SNAI2 overexpression due to reduction of miR-203 may result in EMT and chemoresistance in GBM via these pathways. Additionally, miR-203 may relieve E-cadherin from transcriptional repression by targeting SNAI2 signaling. Nevertheless, because one single miRNA might have multiple targets, judicious considerations are essential for identi cation of the main functional targets.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [9]

• Sensitive Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Sensitive Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: BaF3-BCR/ABLT315I cells; Bone marrow; Homo sapiens (Human); CVCL_UE64
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Interference BCR/ABL expression with miR-203 restored the sensitivity to imatinib in cells expressing the imatinib-resistant BCR/ABL kinase domain mutant T315I.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [10]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: We validated ATM as a bona fide target of miR-203 in CRC cells. Mutation of the putative miR-203 binding site in the 3' untranslated region (3'UTR) of the ATM mRNA abolished the inhibitory effect of miR-203 on ATM. Furthermore, stable knockdown of ATM induced resistance to oxaliplatin in chemo-na ve CRC cells.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [11]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K signaling pathway; Regulation; hsa04151
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: HCT15 cells; Colon; Homo sapiens (Human); CVCL_0292
• Experiment for Molecule Alteration: RT-PCR; Northern blotting analysis
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: the tumor suppressive role of miR-203 was mediated by negatively regulating Akt2 protein expression through mRNA degradation. The inhibition of Akt2 activity downregulated the protein expression of its downstream molecules involved in chemoresistance, such as MTDH and HSP90 genes.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [12]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HT144 cells; Skin; Homo sapiens (Human); CVCL_0318
• In Vitro Model: SkMEL5 cells; Skin; Homo sapiens (Human); CVCL_0527
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR203 sensitizes MM cells to TMZ by targeting GLS.

Disease Class: Glioblastoma [13]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR203-TS signaling pathway; Regulation; hsa05206
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: miR203 re-sensitizes TMZ resistant cells through directly targeting TS.

Disease Class: Glioma [14]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A172 cells; Brain; Homo sapiens (Human); CVCL_0131
• In Vitro Model: U251-MG cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87MG cells; Brain; Homo sapiens (Human); CVCL_GP63
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-203 was reversely associated with migration and invasion, and positively associated with chemosensitivity in glioma cells. E2F3 was shown to be a novel target of miR-203 and E2F3 knockdown exerted a similar effect to that of miR-203 overexpression. These results indicate that miR-203 may act as a tumor suppressor by targeting E2F3 in glioma cells and that miR-203/E2F3 may be a novel candidate for developing rational therapeutic strategies in glioma treatment.

Clinical Trial Drug(s) 1 drug(s) in total

Canertinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [15]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Canertinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: EGFR/RAS signaling pathway; Activation; hsa01521
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Promega assay
• Mechanism Description: The induction of bone metastasis and TkI resistance require miR-203 down-regulation, activation of the EGFR pathway via altered expression of EGFR ligands (EREG and TGFA) and anti-apoptotic proteins (API5, BIRC2, and TRIAP1). Importantly, a sufficient reconstitution of invasiveness and resistance to TkIs treatment was observed in cells transfected with anti-miR-203. In prostate cancer patients, miR-203 levels were inversely correlated with the expression of two EGFR ligands, EREG and TGFA, and an EGFR dependent gene signature.

Investigative Drug(s) 1 drug(s) in total

Tyrphostin AG-1478

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [15]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Tyrphostin AG-1478
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: EGFR/RAS signaling pathway; Activation; hsa01521
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Promega assay
• Mechanism Description: The induction of bone metastasis and TkI resistance require miR-203 down-regulation, activation of the EGFR pathway via altered expression of EGFR ligands (EREG and TGFA) and anti-apoptotic proteins (API5, BIRC2, and TRIAP1). Importantly, a sufficient reconstitution of invasiveness and resistance to TkIs treatment was observed in cells transfected with anti-miR-203. In prostate cancer patients, miR-203 levels were inversely correlated with the expression of two EGFR ligands, EREG and TGFA, and an EGFR dependent gene signature.

References

• Ref 1: Overexpression of miR-203 increases the sensitivity of NSCLC A549/H460 cell lines to cisplatin by targeting Dickkopf-1. Oncol Rep. 2017 Apr;37(4):2129-2136. doi: 10.3892/or.2017.5505. Epub 2017 Mar 13.
• Ref 2: A directly negative interaction of miR-203 and ZEB2 modulates tumor stemness and chemotherapy resistance in nasopharyngeal carcinoma. Oncotarget. 2016 Oct 11;7(41):67288-67301. doi: 10.18632/oncotarget.11691.
• Ref 3: miR-203 inhibits cell proliferation and promotes cisplatin induced cell death in tongue squamous cancer. Biochem Biophys Res Commun. 2016 Apr 29;473(2):382-7. doi: 10.1016/j.bbrc.2016.02.105. Epub 2016 Mar 3.
• Ref 4: MicroRNA-203 Is a Prognostic Indicator in Bladder Cancer and Enhances Chemosensitivity to Cisplatin via Apoptosis by Targeting Bcl-w and Survivin. PLoS One. 2015 Nov 23;10(11):e0143441. doi: 10.1371/journal.pone.0143441. eCollection 2015.
• Ref 5: Anti-miR-203 Upregulates SOCS3 Expression in Breast Cancer Cells and Enhances Cisplatin Chemosensitivity. Genes Cancer. 2011 Jul;2(7):720-7. doi: 10.1177/1947601911425832.
• Ref 6: Direct interaction between miR-203 and ZEB2 suppresses epithelial-mesenchymal transition signaling and reduces lung adenocarcinoma chemoresistance. Acta Biochim Biophys Sin (Shanghai). 2016 Nov;48(11):1042-1049. doi: 10.1093/abbs/gmw099. Epub 2016 Oct 12.
• Ref 7: A Bmi1-miRNAs cross-talk modulates chemotherapy response to 5-fluorouracil in breast cancer cells. PLoS One. 2013 Sep 9;8(9):e73268. doi: 10.1371/journal.pone.0073268. eCollection 2013.
• Ref 8: MiR-203 downregulation is responsible for chemoresistance in human glioblastoma by promoting epithelial-mesenchymal transition via SNAI2. Oncotarget. 2015 Apr 20;6(11):8914-28. doi: 10.18632/oncotarget.3563.
• Ref 9: Inhibition of BCR/ABL protein expression by miR-203 sensitizes for imatinib mesylate. PLoS One. 2013 Apr 16;8(4):e61858. doi: 10.1371/journal.pone.0061858. Print 2013.
• Ref 10: miR-203 induces oxaliplatin resistance in colorectal cancer cells by negatively regulating ATM kinase. Mol Oncol. 2014 Feb;8(1):83-92. doi: 10.1016/j.molonc.2013.09.004. Epub 2013 Oct 8.
• Ref 11: miR-203 reverses chemoresistance in p53-mutated colon cancer cells through downregulation of Akt2 expression. Cancer Lett. 2011 May 1;304(1):52-9. doi: 10.1016/j.canlet.2011.02.003. Epub 2011 Feb 26.
• Ref 12: Sensitization of melanoma cells to temozolomide by overexpression of microRNA 203 through direct targeting of glutaminase-mediated glutamine metabolism. Clin Exp Dermatol. 2017 Aug;42(6):614-621. doi: 10.1111/ced.13119. Epub 2017 Jun 9.
• Ref 13: MALAT1 is a prognostic factor in glioblastoma multiforme and induces chemoresistance to temozolomide through suppressing miR-203 and promoting thymidylate synthase expression. Oncotarget. 2017 Apr 4;8(14):22783-22799. doi: 10.18632/oncotarget.15199.
• Ref 14: MiR-203 sensitizes glioma cells to temozolomide and inhibits glioma cell invasion by targeting E2F3. Mol Med Rep. 2015 Apr;11(4):2838-44. doi: 10.3892/mmr.2014.3101. Epub 2014 Dec 16.
• Ref 15: Loss of EGFR signaling regulated miR-203 promotes prostate cancer bone metastasis and tyrosine kinase inhibitors resistance. Oncotarget. 2014 Jun 15;5(11):3770-84. doi: 10.18632/oncotarget.1994.