Molecule Information

General Information of the Molecule (ID: Mol01363)

• Name: hsa-mir-29b ,Homo sapiens
• Synonyms: microRNA 29b-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR29B1
• Gene ID: 407024
• Location: chr7:130877459-130877539[-]
• Sequence:
  CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUU
  UGAAAUCAGUGUUCUUGGGGG
• Ensembl ID: ENSG00000283797
• HGNC ID: HGNC:31619
• Precursor Accession: MI0000105

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: CP70 cells; Ovary; Homo sapiens (Human); CVCL_0135
• In Vitro Model: HeyC2 cells; Ovary; Homo sapiens (Human); CVCL_X009
• In Vivo Model: NOD/SCID nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Knockdown of miR-29a/b/c increased the ability of cells to escape cisplatin-induced cell death partly through upregulation of collagen type I alpha 1 (COL1A1) and increased the activation of extracellular signal-regulated kinase 1/2 and inactivation of glycogen synthase kinase 3 beta.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: The expression of miR-29b was significantly upregualted by cisplatin treatment,while its target gene AkT2 was downregulated. The up-regulation of miR-29b (+) the sensitivity of gastric cancer cells to cisplatin,while the knock-down of miR-29b (+) the cisplatin resistance. Rescue experiments demonstrated that the miR-29b might regulate cisplatin resistance of gastric cancer cell by targeting PI3k/Akt pathway. The expressions of the other two members of miR-29 family, miR-29a/c, were promoted by cisplatin treatment,but they had no significant effect on gastric cancer cell's resistance to cisplatin.

Disease Class: Osteosarcoma [3]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: 3AB-OS CSC cells; Bone marrow; Homo sapiens (Human); CVCL_LM95
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Trypan blue assay; Flow cytometry assay
• Mechanism Description: miR-29b-1 overexpression sensitized 3AB-OS cells to chemotherapeutic drug-induced apoptosis miR-29b-1 negatively regulated the expression of Bcl-2.

Disease Class: Ovarian cancer [4]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR29b signaling pathway; Regulation; hsa05206
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: H&E staining assay
• Mechanism Description: The ATG9A down expression due to miR-29b increasing could significantly promote Ovarian carcinoma drug sensitivity on different chemotherapeutic drugs (Cisplatin, Paclitaxel, Platinum, Cyclophosphamide).

Cyclophosphamide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [4]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cyclophosphamide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR29b signaling pathway; Regulation; hsa05206
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: H&E staining assay
• Mechanism Description: The ATG9A down expression due to miR-29b increasing could significantly promote Ovarian carcinoma drug sensitivity on different chemotherapeutic drugs (Cisplatin, Paclitaxel, Platinum, Cyclophosphamide).

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Negroid cervix epitheloid carcinoma [5]

• Sensitive Disease: Negroid cervix epitheloid carcinoma [ICD-11: 2E66.Y]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: xCELLigence cell viability assay; Flow cytometry assay; Caspase-3 activity assay
• Mechanism Description: microRNA hsa-miR29b potentiates etoposide toxicity in HeLa cells via down-regulation of Mcl-1.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cholangiocarcinoma [6]

• Sensitive Disease: Cholangiocarcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HuCCT1 cells; Bile duct; Homo sapiens (Human); CVCL_0324
• In Vitro Model: HuH28 cells; Bile duct; Homo sapiens (Human); CVCL_2955
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Two miR-29b target genes, PIk3R1 and MMP-2, that are, at least partly, responsible for the resistance of CCA Gem treatment. PIk3R1 encodes phosphoinositide 3-kinase (PI3k) regulatory subunit designated p85 alpha; p85 alpha is regarded as integrator of multiple signaling pathways that together promote cell proliferation, cell survival, and carcinogenesis.

Methotrexate

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [7]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Methotrexate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Overexpression of miR-29b suppressed MTX resistance and promoted cell apoptosis by downregulating MCL1 expression.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [4]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR29b signaling pathway; Regulation; hsa05206
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: H&E staining assay
• Mechanism Description: The ATG9A down expression due to miR-29b increasing could significantly promote Ovarian carcinoma drug sensitivity on different chemotherapeutic drugs (Cisplatin, Paclitaxel, Platinum, Cyclophosphamide).

Investigative Drug(s) 1 drug(s) in total

Platinum

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [4]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Platinum
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR29b signaling pathway; Regulation; hsa05206
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: H&E staining assay
• Mechanism Description: The ATG9A down expression due to miR-29b increasing could significantly promote Ovarian carcinoma drug sensitivity on different chemotherapeutic drugs (Cisplatin, Paclitaxel, Platinum, Cyclophosphamide).

References

• Ref 1: Downregulation of miR-29 contributes to cisplatin resistance of ovarian cancer cells. Int J Cancer. 2014 Feb 1;134(3):542-51. doi: 10.1002/ijc.28399. Epub 2013 Aug 28.
• Ref 2: [miR-29b Reduces Cisplatin Resistance of Gastric Cancer Cell by Targeting PI3K/Akt Pathway]. Zhongguo Yi Xue Ke Xue Yuan Xue Bao. 2015 Oct;37(5):514-9. doi: 10.3881/j.issn.1000-503X.2015.05.005.
• Ref 3: MicroRNA-29b-1 impairs in vitro cell proliferation, self renewal and chemoresistance of human osteosarcoma 3AB-OS cancer stem cells. Int J Oncol. 2014 Nov;45(5):2013-23. doi: 10.3892/ijo.2014.2618. Epub 2014 Aug 22.
• Ref 4: Involvement of miR-29b signaling in the sensitivity to chemotherapy in patients with ovarian carcinoma. Hum Pathol. 2014 Jun;45(6):1285-93. doi: 10.1016/j.humpath.2014.02.008. Epub 2014 Feb 28.
• Ref 5: MicroRNA hsa-miR-29b potentiates etoposide toxicity in HeLa cells via down-regulation of Mcl-1. Toxicol In Vitro. 2017 Apr;40:289-296. doi: 10.1016/j.tiv.2017.02.005. Epub 2017 Feb 6.
• Ref 6: miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells. PLoS One. 2013 Oct 17;8(10):e77623. doi: 10.1371/journal.pone.0077623. eCollection 2013.
• Ref 7: miR-29 Family Inhibits Resistance to Methotrexate and Promotes Cell Apoptosis by Targeting COL3A1 and MCL1 in Osteosarcoma. Med Sci Monit. 2018 Dec 6;24:8812-8821. doi: 10.12659/MSM.911972.