Molecule Information

General Information of the Molecule (ID: Mol01343)
Name
hsa-mir-21 ,Homo sapiens
Synonyms
microRNA 21
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR21
Gene ID
406991
Location
chr17:59841266-59841337[+]
Sequence
UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUG
GGCUGUCUGACA
    Click to Show/Hide
Ensembl ID
ENSG00000284190
HGNC ID
HGNC:31586
Precursor Accession
MI0000077
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
26 drug(s) in total
Click to Show/Hide the Full List of Drugs
Arsenic trioxide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Leukemia [1]
Resistant Disease Leukemia [ICD-11: 2B33.6]
 Disease Info 
Resistant Drug Arsenic trioxide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
K562 cells Blood Homo sapiens (Human) CVCL_0004
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description PDCD4 has been reported to be involved in growth, apoptosis, invasion and cell cycle etc. AMO-miR-21 significantly sensitizes HL60 and k562 cells to ATO by inducing apoptosis, and these effects of AMO-miR-21 may be partially due to its up-regulation of PDCD4.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myelogenous leukemia [2]
Sensitive Disease Chronic myelogenous leukemia [ICD-11: 2A20.3]
 Disease Info 
Sensitive Drug Arsenic trioxide
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell growth Inhibition hsa05200
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 post-transcriptionally down-regulates tumor suppressor PDCD4. AMO-miR-21 sensitized leukemic k562 cells to ATO by inducing apoptosis partially due to its up-regulation of PDCD4 protein level.
Carmustine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [3]
Resistant Disease Glioma [ICD-11: 2A00.1]
 Disease Info 
Resistant Drug Carmustine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SWOZ2 cells Brain Homo sapiens (Human) N.A.
SWOZ2-BCNU cells Brain Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR21 enhanced glioma cells resistance to carmustine via decreasing Spry2 expression.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cervical cancer [4]
Resistant Disease Cervical cancer [ICD-11: 2C77.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
STAT3 signaling pathway Activation hsa04550
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Siha cells Cervix uteri Homo sapiens (Human) CVCL_0032
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay; Colony formation assay
Mechanism Description Down-regulation of LncRNA GAS5 strengthen cisplatin-induced apoptosis in cervical cancer by regulating STAT3 signaling via miR-21.
Disease Class: Ovarian cancer [5]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PTEN/PI3K/AKT signaling pathway Regulation hsa05235
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
SkOV3/DDP cells Ovary Homo sapiens (Human) CVCL_0532
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miRNA-21 enhances chemoresistance to cisplatin in epithelial ovarian cancer by negatively regulating PTEN.
Disease Class: Non-small cell lung cancer [6]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT signaling pathway Regulation hsa04151
miR21/PTEN signaling pathway Regulation hsa05206
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Sk-MES-1 cells Lung Homo sapiens (Human) CVCL_0630
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
16HBE cells Lung Homo sapiens (Human) CVCL_0112
H157 cells Lung Homo sapiens (Human) CVCL_2458
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Soft agar assay
Mechanism Description miR21 acts as an oncogenic miRNA through targeting PTEN in many cancers. By negatively regulating the intracellular levels of PI3k, PTEN exerts a suppressive effect on tumor through AkT pathway. miR21 was involved in GAS5 regulation of NSCLC sensitivity to DDP through PTEN pathway.
Disease Class: Lung cancer [7]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT signaling pathway Inhibition hsa04151
Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
PI3K signaling pathway Inhibition hsa04151
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 Vi-cell cell viability analyzer assay
Mechanism Description miR-21 achieves the drug resistance effect through three mechanisms: Increasing MDR1 and MPR1 expression levels, and enhancing drug efflux from the cells; increasing GSH, superoxide dismutase and GST-Pi expression levels and promoting drug inactivation; and inhibiting the PI3k signaling pathway and in turn inhibiting apoptotic signaling.
Disease Class: Ovarian cancer [8]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
JNk1/c-Jun pathway Activation hsa04010
In Vitro Model Hey A8 cells Ovary Homo sapiens (Human) CVCL_8878
SkVO3ip1 cells Ovary Homo sapiens (Human) CVCL_0C84
A2780CP20 cells Ovary Homo sapiens (Human) CVCL_A5PS
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Alamar blue dye assay
Mechanism Description Blocking the JNk-1, the major activator of c-Jun phosphorylation, reduced the expression of pre-mir-21 and increased the expression of its well-known target gene, PDCD4. Overexpression of miR-21 in cisplatin sensitive cells decreased PDCD4 levels and increased cell proliferation. Finally, targeting miR-21 reduced cell growth, proliferation and invasion of cisplatin resistant ovarian cancer cells. These results suggest that the JNk-1/c-Jun/miR-21 pathway contributes to the cisplatin resistance of ovarian cancer cells and demonstrated that miR-21 is a plausible target to overcome cisplatin resistance.
Disease Class: Non-small cell lung cancer [9], [10]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
PTEN signaling pathway Inhibition hsa05235
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/CDDP cells Lung Homo sapiens (Human) CVCL_0023
KB-3-1 cells Lung Homo sapiens (Human) CVCL_2088
KB-CP.5 cells Lung Homo sapiens (Human) CVCL_IP04
KB-CP20 cells Lung Homo sapiens (Human) CVCL_IP06
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 decreased the expression of PTEN and increased Bcl-2 in A549. Upregulation of miR-21 induces cholangiocarcinoma cell survival and gemcitabine resistance primarily through targeting the PTEN dependent PI3k/Akt pathway. Inhibition of miR-21 was shown to increase the sensitivity to topotecan in breast cancer cells partly by regulating BCL2 induced anti-apoptosis indirectly in MCF-7 cells.
Disease Class: Tongue squamous cell carcinoma [11]
Resistant Disease Tongue squamous cell carcinoma [ICD-11: 2B62.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model Tca8113 cells Tongue Homo sapiens (Human) CVCL_6851
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Programmed cell death 4 (PDCD4) is a tumor suppressor gene and loss of PDCD4 expression was found in multiple human cancers. PDCD4 is an important functional target of miR-21 and related to tumor invasion and transformation. miR-21 could modulate chemosensitivity of TSCC cells to cisplatin by targeting PDCD4.
Disease Class: Ovarian cancer [12]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
A2780-CP cells Ovary Homo sapiens (Human) CVCL_H745
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The inhibition of miR-21 enhanced the sensitivity of ovarian cancer cells to cisplatin, miR-21 knockdown enhanced the expression of tumor suppressor PDCD4, downregulation of PDCD4 results in drug resistance via enhanced expression of c-IAP2 and MDR1.
Disease Class: Gastric cancer [13]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell cycle Inhibition hsa04110
Cell viability Activation hsa05200
PTEN/PI3K/AKT signaling pathway Activation hsa05235
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/DDP cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The staining of PTEN was reversely correlated with miR-21 levels in tongue squamous cell carcinoma patients, PTEN is an important tumor suppressor gene and the functional inactivation of PTEN by regulation of its expression is relevant to many solid tumors. PETN involved in gastric cancer pathology and its down-regulation can lead to chemotherapeutic drug including cisplatin resistance in gastric cancer patients.
Disease Class: Neuroblastoma [14]
Resistant Disease Neuroblastoma [ICD-11: 2A00.11]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SH-SY5Y cells Abdomen Homo sapiens (Human) CVCL_0019
BE(2) -M17 cells Brain Homo sapiens (Human) CVCL_0167
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Increased miR-21 expression might suppress the PTEN expression and eventually induce chemoresistance to cisplatin and increase cell proliferation.
Disease Class: Tongue squamous cell carcinoma [15]
Resistant Disease Tongue squamous cell carcinoma [ICD-11: 2B62.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Tca8113 cells Tongue Homo sapiens (Human) CVCL_6851
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 was found decreased as with chemosensitivity for cisplatin in the Tca/cisplatin cells.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Gastric cancer [16]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PI3K/AKT signaling pathway Activation hsa04151
In Vitro Model MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
MFC cells Gastric Homo sapiens (Human) CVCL_5J48
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; FITC Annexin V Apoptosis Detection assay; Flow cytometric analysis
Mechanism Description Exosomal transfer of tumor-associated macrophages derived miR21 confer DDP resistance in gastric cancer Exosomal miR21 can be directly transferred from macrophages to the gastric cancer cells, where it suppresses cell apoptosis and enhances activation of PI3k/AkT signaling pathway by down-regulation of PTEN.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cervical cancer [17]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation PTEN signaling pathway Activation hsa05235
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Siha cells Cervix uteri Homo sapiens (Human) CVCL_0032
Caski cells Uterus Homo sapiens (Human) CVCL_1100
ME-180 cells Uterus Homo sapiens (Human) CVCL_1401
H8 cells Uterus Homo sapiens (Human) CVCL_9389
HCE1 cells Uterus Homo sapiens (Human) CVCL_A8SM
Experiment for
Molecule Alteration		 qRT-PCR; Luciferase reporter assay
Experiment for
Drug Resistance		 MTT assay
Mechanism Description CASC2 upregulated PTEN expression by direct inhibiting miR21 in the DDP-resistant cancer cells, leading to the down-regulation of p-AkT protein, CASC2 up-regulates PTEN as a ceRNA of miR21. Inhibiting miR21 increased the sensitivity of human glioblastoma cells U251 and LN229 to taxol.
Disease Class: Non-small cell lung cancer [18], [19]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Sk-MES-1 cells Lung Homo sapiens (Human) CVCL_0630
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description Down-regulation of miR-21 inhibited growth, colony formation, antiapoptotic Bcl-2 expression and promoted proapoptotic Bax and caspase-9 expression in A549 cells treated with DDP. Upregulation of miR-21 promoted growth and colony formation in Sk-MES-1 cells treated with DDP. Furthermore, downregulation of miR-21 reduced growth of implanted tumors, suggesting that miR-21 inhibition could enhance the sensitivity of A549 cells to DDP in vivo. These data suggest an appropriate combination of DDP and miR-21 regulation might be a potential approach to lung cancer therapy. Combined DDP application with miR-21 downregulation for the treatment of lung cancer would help achieve effective treatment and reduce DDP side effects.
Disease Class: Osteosarcoma [20]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
HOS cells Bone Homo sapiens (Human) CVCL_0312
143B cells Bone Homo sapiens (Human) CVCL_2270
HLNG cells Bone marrow Homo sapiens (Human) N.A.
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 Northern blot analysis
Experiment for
Drug Resistance		 Scratch assay
Mechanism Description miR-21 regulatory network plays a role in tumorigenesis of osteosarcoma. Its expression facilitates cell proliferation and decreases cellular sensitivity towards cisplatin. Both effects can be rescued by Spry2, a target protein downregulated by increased miR-21 levels.
Disease Class: Tongue squamous cell carcinoma [21]
Sensitive Disease Tongue squamous cell carcinoma [ICD-11: 2B62.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model CA-27 cells Mouth Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Down-regulation of miR-21 could sensitize CA-27 cells to cisplatin possibly by increasing cisplatin induced apoptosis.
Cyclophosphamide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [22]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Sensitive Drug Cyclophosphamide
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model CRL2631 cells Bone marrow Homo sapiens (Human) CVCL_3611
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 impacts the PI3k/AkT signaling pathway through the regulation of PTEN, thereby affecting cellular sensitivity to the CHOP chemotherapeutic regimen.
Cytarabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute myeloid leukemia [23]
Sensitive Disease Acute myeloid leukemia [ICD-11: 2A60.0]
 Disease Info 
Sensitive Drug Cytarabine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description AMO-miR-21 significantly sensitizes HL60 cells to Ara-C byinducing apoptosis and these effects of AMO-miR-21 may be partially due to its up-regulation ofPDCD4.
Daunorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Leukemia [24]
Resistant Disease Leukemia [ICD-11: 2B33.6]
 Disease Info 
Resistant Drug Daunorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Activation hsa04151
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
K562/DNR cells Blood Homo sapiens (Human) CVCL_4T87
Experiment for
Molecule Alteration		 RT-PCR; Northern blotting analysis
Experiment for
Drug Resistance		 MTT assay
Mechanism Description DNR-induced drug resistance is associated with upregulation of miR-21 in the leukaemia cell line k562. miR-21 may regulate the survival of leukaemia cell lines by targeting PTEN expression and causing subsequent changes in the PI3k/Akt pathway.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [10]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
PTEN signaling pathway Inhibition hsa05235
In Vitro Model KB-3-1 cells Lung Homo sapiens (Human) CVCL_2088
KB-CP.5 cells Lung Homo sapiens (Human) CVCL_IP04
KB-CP20 cells Lung Homo sapiens (Human) CVCL_IP06
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description PTEN, a tumor suppressor gene, is an essential regulator of cell proliferation, differentiation, growth, and apoptosis. miR-21 can promote growth, migration, and invasion, chemo- or radioresistance of NSCLC cells by downregulation PTEN.
Disease Class: Prostate cancer [25]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Resistant Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model PC3 cells Prostate Homo sapiens (Human) CVCL_0035
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Programmed cell death 4 (PDCD4), is a novel suppressor of tumorigenesis, tumor progression and invasion. miR-21 can directly down-regulate the expression of PDCD4 by targeting its 3'UTR in PC3 cells. PDCD4, a direct target gene of miR-21, could mediate chemoresistance to docetaxel in PC3 cells.
Dovitinib lactate
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Renal carcinoma [26]
Sensitive Disease Renal carcinoma [ICD-11: 2C90.2]
 Disease Info 
Sensitive Drug Dovitinib lactate
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model 786-O cells Kidney Homo sapiens (Human) CVCL_1051
ACHN cells Pleural effusion Homo sapiens (Human) CVCL_1067
HK-2 cells Kidney Homo sapiens (Human) CVCL_0302
RCC10 cells Kidney Homo sapiens (Human) CVCL_6265
RCC4 cells Kidney Homo sapiens (Human) CVCL_0498
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 Celltiter96 Aqueous Non Radioactive Cell Proliferation Assay
Mechanism Description Tumor suppressor genes like PTEN, PDCD4 and TIMP3, are target genes of miR21. PTEN is a potent inhibitor of PI3k/Akt pathway, as well as a direct target of miR21.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [27]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PI3K/AKT/mTOR signaling pathway Activation hsa04151
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
K562/A02 cells Blood Homo sapiens (Human) CVCL_0368
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 is associated with inactivation of PTEN, a know tumor suppressor gene, resulting in activation of PI3k/Akt/mTOR signaling pathway, Akt promotes cell survival by inhibiting apoptosis through its ability to phosphorylate/inactivate downstream targets of apoptotic machinery. ADR sensitivity is associated with up-regulation of PTEN resulting from the inhibition of miR-21 expression.
Disease Class: Breast cancer [28]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7/ADR cells Breast Homo sapiens (Human) CVCL_1452
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 regulates ADR resistance of breast cancer cells, at least in part, by targeting the tumor suppressor gene PTEN.
Disease Class: Bladder cancer [29]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
PI3K/AKT signaling pathway Activation hsa04151
In Vitro Model T24 cells Bladder Homo sapiens (Human) CVCL_0554
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description A negative correlation between expression of miR-21 and pten was established in vivo. cell proliferation and chemoresistance to doxorubicin were promoted by overexpression of miR-21 in t24 cells. Bcl-2 up-regulation could be achieved by miR-21 overexpression, which prevented t24 cells from apoptosis induced by doxorubicin.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [30]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model A172 cells Brain Homo sapiens (Human) CVCL_0131
T98G cells Brain Homo sapiens (Human) CVCL_0556
U87MG cells Brain Homo sapiens (Human) CVCL_GP63
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; TUNEL assay
Mechanism Description To validate the possible association of miR-21 with drug resistance of T98G cells, we transfected anti-miR-21 inhibitor into the cells. The expression level of miR-21 was significantly lower in T98G transfected cells (than in the parental control cells). Transfected cells showed a high apoptotic rate compared to control after Dox treatment by TUNEL assay, suggesting that combined Dox and miR-21 inhibitor therapy can sensitize GBM resistant cells to anthracyclines by enhancing apoptosis.
Disease Class: Breast cancer [31]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
c-Jun signaling pathway Inhibition hsa04210
In Vitro Model MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
Experiment for
Molecule Alteration		 PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description HA/CD44 activates c-Jun signaling which, in turn, stimulates miR-21 expression and function. These events lead to the production of an anti-apoptosis protein, Bcl-2 and upregulation of survival proteins (IAPs) and Doxorubicin chemoresistance in MDA-MB-468 cells. cells. Inhibition of c-Jun signaling or silencing miR-21 expression/function not only results in Bcl-2 downregulation, but also causes a reduction of survival protein expression and enhances chemosensitivity to Doxorubicin.
Disease Class: Diffuse large B-cell lymphoma [22]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model CRL2631 cells Bone marrow Homo sapiens (Human) CVCL_3611
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 impacts the PI3k/AkT signaling pathway through the regulation of PTEN, thereby affecting cellular sensitivity to the CHOP chemotherapeutic regimen.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [32]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
PI3K/AKT/mTOR signaling pathway Regulation hsa04151
In Vitro Model PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
PATU8988 cells Pancreas Homo sapiens (Human) CVCL_1846
293TN cells Pancreas Homo sapiens (Human) CVCL_UL49
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR-21 regulates 5-FU drug resistance in pancreatic cancer by reducing the expression of its targets, PTEN and PDCD4. And PTEN and PDCD4, as tumor suppressors, not only can inhibit tumor growth and invasion, but also can downregulate the 5-FU resistance induced by miR-21 in pancreatic cancer cells.
Disease Class: Colon cancer [33]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PI3K/AKT signaling pathway Regulation hsa04151
In Vitro Model RkO cells Colon Homo sapiens (Human) CVCL_0504
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 can mediate the drug resistance to 5-FU by inhibiting its target PDCD4, which can regulate the expression of ABCC5 and CD44 genes.
Disease Class: Colon cancer [34], [35]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model HT-29 cells Colon Homo sapiens (Human) CVCL_0320
HT-29/5-FU cells Colon Homo sapiens (Human) CVCL_0I27
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description miR-21 targeted the human mutS homolog2 (hMSH2), and indirectly regulated the expression of thymidine phosphorylase (TP) and dihydropyrimidine dehydrogenase (DPD). These results demonstrate that miR-21 may play an important role in the 5-FU resistance of colon cancer cells. And high miR-21 expression was significantly associated with poor therapeutic outcome (P = 0.0001) and adjuvant therapy was associated with improved survival in patients with low miR-21.
Disease Class: Colorectal cancer [36]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
COLO 320DM cells Colon Homo sapiens (Human) CVCL_0219
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 FACS analysis
Mechanism Description The mismatch repair (MMR) system is involved in DNA damage recognition and repair. Human mutS homolog 2 (hMSH2) and human mutL homolog 1 (hMLH1) function as core MMR proteins and form heterodimers with protein homologs hMSH3 or hMSH6 and hMLH3 or hPMS2, respectively. Colorectal tumors that express a high level of miR-21 display reduced hMSH2 protein expression. Cells that overproduce miR-21 exhibit significantly reduced 5-fluorouracil (5-FU) -induced G2/M damage arrest and apoptosis that is characteristic of defects in the core MMR component.
Disease Class: Hepatocellular carcinoma [37]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell viability Activation hsa05200
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
PLC/PRF/5 cells Liver Homo sapiens (Human) CVCL_0485
HLE cells Liver Homo sapiens (Human) CVCL_1281
HLF cells Liver Homo sapiens (Human) CVCL_2947
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Hepatocellular carcinoma cells transfected with pre-miR-21 were significantly resistant to IFN-alpha/5-FU. Transfection of anti-miR-21 rendered HCC cells sensitive to IFN-alpha/5-FU, and such sensitivity was weakened by transfection of siRNAs of target molecules, PETN and PDCD4, miR-21 induces chemoresistance to IFN-alpha and 5-FU, mediated through PETN and PDCD4.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Renal carcinoma [26]
Sensitive Disease Renal carcinoma [ICD-11: 2C90.2]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model 786-O cells Kidney Homo sapiens (Human) CVCL_1051
ACHN cells Pleural effusion Homo sapiens (Human) CVCL_1067
HK-2 cells Kidney Homo sapiens (Human) CVCL_0302
RCC10 cells Kidney Homo sapiens (Human) CVCL_6265
RCC4 cells Kidney Homo sapiens (Human) CVCL_0498
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 Celltiter96 Aqueous Non Radioactive Cell Proliferation Assay
Mechanism Description Tumor suppressor genes like PTEN, PDCD4 and TIMP3, are target genes of miR21. PTEN is a potent inhibitor of PI3k/Akt pathway, as well as a direct target of miR21.
Disease Class: Pancreatic cancer [38]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
HPAC cells Pancreas Homo sapiens (Human) CVCL_3517
HPAF-II cells Pancreatic Homo sapiens (Human) CVCL_0313
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 SRB (sulforhodamine-B) assay
Mechanism Description Low miR-21 expression was associated with benefit from adjuvant treatment in two independent cohorts of PDAC cases, and anti-miR-21 increased anticancer drug activity in vitro.
Fulvestrant
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [39]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Fulvestrant
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
PI3K/AKT/mTOR signaling pathway Regulation hsa04151
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 is a miRNA that is overexpressed in most tumor types, and acts as an oncogene by targeting many suppressor genes related to proliferation, apoptosis, and invasion. miR-21 facilitates tumor growth and invasion by targeting programmed cell death 4 (PDCD4), PTEN, and Bcl-2. silencing of miR-21 sensitized ER+ breast cancer cells to TAM and FUL induced cell apoptosis.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [40]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation AKT/ERK signaling pathway Activation hsa04010
Cell apoptosis Inhibition hsa04210
Cell migration Inhibition hsa04670
In Vitro Model PC9 cells Lung Homo sapiens (Human) CVCL_B260
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description miR-21 was up-regulated concomitantly to down-regulation of Pten in pc-9/GR cells in comparison with pc-9 cells. Moreover, over-expression of miR-21 significantly decreased gefitinib sensitivity by down-regulating Pten expression and activating Akt and ERk pathways in pc-9 cells, while miR-21 knockdown dramatically restored gefitinib sensitivity of pc-9/GR cells by up-regulation of Pten expression and inactivation of AkT and ERk pathways, in vivo and in vitro.
Disease Class: Non-small cell lung cancer [41]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
PI3K/AKT signaling pathway Activation hsa04151
In Vitro Model PC9 cells Lung Homo sapiens (Human) CVCL_B260
PC9R cells Lung Homo sapiens (Human) CVCL_D778
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 overexpression is associated with the acquired resistance of EGFR-TkI in NSCLC, which might be caused by miR-21's function of activating PI3k/AkT pathway through inhibiting PTEN and PDCD4.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [42], [43], [44]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation AKT signaling pathway Activation hsa04151
Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
FasL/Fas signaling pathway Inhibition hsa04210
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
LPc006 cells Pancreas Homo sapiens (Human) N.A.
LPc028 cells Pancreas Homo sapiens (Human) N.A.
LPc033 cells Pancreas Homo sapiens (Human) N.A.
LPc067 cells Pancreas Homo sapiens (Human) N.A.
LPc111 cells Pancreas Homo sapiens (Human) N.A.
LPc167 cells Pancreas Homo sapiens (Human) N.A.
PP437 cells Pancreas Homo sapiens (Human) N.A.
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 WST-8 assay; Fluorescence microscopy
Mechanism Description miR-21 regulates expression of PTEN and phosphorylation of its downstream kinase Akt and (b) the reduction of phospho-Akt (pAkt) correlated with the enhancement of gemcitabine-induced apoptosis and antitumor activity in vitro and in vivo, suggesting that Akt pathway plays a significant role in mediating drug resistance in PDAC cells.
Disease Class: Pancreatic ductal adenocarcinoma [45]
Resistant Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
In Vitro Model PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
HPAC cells Pancreas Homo sapiens (Human) CVCL_3517
BxPc3 cells Pancreas Homo sapiens (Human) CVCL_0186
Capan cells Pancreas Homo sapiens (Human) CVCL_0237
HPAF cells Pancreas Homo sapiens (Human) CVCL_B284
PL-45 cells Pancreas Homo sapiens (Human) CVCL_3567
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Histone acetylation levels at miR-21 promoter were increased in PDAC cells after treatment with gemcitabine. Enhanced invasion and metastasis, increased miR-21 expression, decreased PTEN, elevated pAkT level were demonstrated in gemcitabine-resistant HPAC and PANC-1 cells. Pre-miR-21 transfection or TSA treatment further increased invasion and metastasis ability, decreased PTEN, and elevated pAkT levels in these two lines. In contrast, anti-miR-21 transfection could reverse invasion and metastasis, and PTEN and pAkT expressions induced by gemcitabine.
Disease Class: Pancreatic ductal adenocarcinoma [46]
Resistant Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Mechanism Description miR-21 is probably the most characterized miRNA associated with gemcitabine resistance. Tissue samples of PDA patients treated with gemcitabine indicate that miR-21 expression is directly correlated with chemotherapy resistance. Patients with high miR-21 expression have significantly shorter overall survival; consistently, overexpression of miR-21 in primary PDA cells in vitro, decreases the anti-proliferative effect of gemcitabine. miR-21 promotes gemcitabine resistance by targeting phosphatase and tensin homologue (PTEN) or by overexpression of matrix metalloproteinases (MMP) 2 and 9, and of vascular endothelial growth factor (VEGF), which in-turn induces the PI3K/AKT pathway.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [47]
Sensitive Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
 Disease Info 
Sensitive Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Panc02 cells Pancreas Homo sapiens (Human) CVCL_D627
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Costar Transwell Invasion Assay;
Mechanism Description Upregulating miR21 in CAFs promoted PDAC desmoplasia and increased its drug resistance to gemcitabine treatment by promoting the activation of cancer-associated fibroblasts (CAFs). miR21 mediates activation of CAFs via down-regulating PDCD4.
Disease Class: Pancreatic cancer [48]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Sensitive Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
Hs-578T cells Breast Homo sapiens (Human) CVCL_0332
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Increased p85alpha expression in PDAC TCs results in decreased PI3k-AkT signaling and increased gemcitabine sensitivity. Expression of p85alpha inversely correlates with miR-21 levels in human PDAC. Overexpression of miR-21 results in decreased levels of p85alpha and increased PI3k-AkT activation.
Disease Class: Pancreatic cancer [38]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Sensitive Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
HPAC cells Pancreas Homo sapiens (Human) CVCL_3517
HPAF-II cells Pancreatic Homo sapiens (Human) CVCL_0313
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 SRB (sulforhodamine-B) assay
Mechanism Description Low miR-21 expression was associated with benefit from adjuvant treatment in two independent cohorts of PDAC cases, and anti-miR-21 increased anticancer drug activity in vitro.
Disease Class: Pancreatic cancer [49]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Sensitive Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
Capan-1 cells Pancreas Homo sapiens (Human) CVCL_0237
Capan-2 cells Pancreas Homo sapiens (Human) CVCL_0026
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
Hs-578T cells Breast Homo sapiens (Human) CVCL_0332
CFPAC1 cells Pancreas Homo sapiens (Human) CVCL_1119
SUIT-2 cells Pancreas Homo sapiens (Human) CVCL_3172
H48N cells Pancreas Homo sapiens (Human) CVCL_D554
KP-1N cells Pancreas Homo sapiens (Human) CVCL_3002
KP-2 cells Pancreas Homo sapiens (Human) CVCL_3004
KP-3 cells Pancreas Homo sapiens (Human) CVCL_3005
NOR-P1 cells Pancreas Homo sapiens (Human) CVCL_4716
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Propidium iodide assay
Mechanism Description The cancer cells transfected with the miR-21 precursor showed significantly increased proliferation, Matrigel invasion, and chemoresistance for gemcitabine compared with the control cells. In contrast, inhibition of miR-21 decreased proliferation, Matrigel invasion, and chemoresistance for gemcitabine. Moreover, miR-21 positively correlated with the mRNA expression of invasion-related genes, matrix metalloproteinase-2 and -9, and vascular endothelial growth factor.
Disease Class: Cholangiocarcinoma [50]
Sensitive Disease Cholangiocarcinoma [ICD-11: 2C12.0]
 Disease Info 
Sensitive Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
PI3K signaling pathway Activation hsa04151
In Vitro Model H69 cells Lung Homo sapiens (Human) CVCL_8121
KMCH-1 cells Gallbladder Homo sapiens (Human) CVCL_7970
Mz-ChA-1 cells Gallbladder Homo sapiens (Human) CVCL_6932
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 Northern blotting analysis
Experiment for
Drug Resistance		 Celltiter 96 aqueous one solution cell proliferation assay
Mechanism Description miR-21, miR-141, and miR-200b werehighly over-expressed in malignant cholangiocytes. Inhibi-tion of miR-21 and miR-200b increased sensitivity to gem-citabine, whereas inhibition of miR-141 decreased cellgrowth. miR-21 modulates gemcitabine-induced apo-ptosis by phosphatase and tensin homolog deleted onchromosome 10 (PTEN) -dependent activation of PI 3-ki-nase signaling.
IFN-alpha
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [37]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug IFN-alpha
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell viability Activation hsa05200
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
PLC/PRF/5 cells Liver Homo sapiens (Human) CVCL_0485
HLE cells Liver Homo sapiens (Human) CVCL_1281
HLF cells Liver Homo sapiens (Human) CVCL_2947
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Hepatocellular carcinoma cells transfected with pre-miR-21 were significantly resistant to IFN-alpha/5-FU. Transfection of anti-miR-21 rendered HCC cells sensitive to IFN-alpha/5-FU, and such sensitivity was weakened by transfection of siRNAs of target molecules, PETN and PDCD4, miR-21 induces chemoresistance to IFN-alpha and 5-FU, mediated through PETN and PDCD4.
Imatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastrointestinal stromal tumor [51]
Sensitive Disease Gastrointestinal stromal tumor [ICD-11: 2B5B.0]
 Disease Info 
Sensitive Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model GIST-T1 cells Gastric Homo sapiens (Human) CVCL_4976
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay; Annexin V-FITC Apoptosis Detection assay
Mechanism Description miRNA-21 sensitizes gastrointesti.l stromal tumors (GISTs) cells to Imatinib via targeting B-cell lymphoma 2 (Bcl-2), miRNA-21 suppressed Bcl-2 expression in GIST cells and could function as a potent tumor suppressor in GIST.
Disease Class: Chronic myeloid leukemia [52]
Sensitive Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Sensitive Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay; Annexin V-FITC/PI Apoptosis Detection assay
Mechanism Description LncRNA MEG3 regulates imatinib resistance in chronic myeloid leukemia via suppressing microRNA-21. MEG3 and miR21 were negatively correlated in CML patients, miR21 mimics reversed the phenotype of MEG3-overexpression in imatinib-resistant k562 cells.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Renal carcinoma [26]
Sensitive Disease Renal carcinoma [ICD-11: 2C90.2]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model 786-O cells Kidney Homo sapiens (Human) CVCL_1051
ACHN cells Pleural effusion Homo sapiens (Human) CVCL_1067
HK-2 cells Kidney Homo sapiens (Human) CVCL_0302
RCC10 cells Kidney Homo sapiens (Human) CVCL_6265
RCC4 cells Kidney Homo sapiens (Human) CVCL_0498
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 Celltiter96 Aqueous Non Radioactive Cell Proliferation Assay
Mechanism Description Tumor suppressor genes like PTEN, PDCD4 and TIMP3, are target genes of miR21. PTEN is a potent inhibitor of PI3k/Akt pathway, as well as a direct target of miR21.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [53]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
TGF signaling pathway Regulation hsa04350
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
Hey A8 cells Ovary Homo sapiens (Human) CVCL_8878
OVCA433 cells Ovary Homo sapiens (Human) CVCL_0475
ALST cells Ovary Homo sapiens (Human) CVCL_W778
HeyA8-MDR cells Ovary Homo sapiens (Human) CVCL_8879
OVCA432 cells Ovary Homo sapiens (Human) CVCL_3769
OVCAR5 cells Ovary Homo sapiens (Human) CVCL_1628
SkOV3-TR cells Ovary Homo sapiens (Human) CVCL_HF69
SkOV3ip cells Ovary Homo sapiens (Human) CVCL_0C84
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The identification of APAF1 as a direct target of miR21 and APAF1 as a mediator of miR21 for conferring chemoresistance in ovarian cancer suggests that strategies based on the upregulation of APAF1 in ovarian cancer cells can be used to sensitize ovarian cancer cells to paclitaxel treatment.ovarian cancer suggests that strategies based on the upregulation of APAF1 in ovarian cancer cells can be used to sensitize ovarian cancer cells to paclitaxel treatment.
Disease Class: Breast cancer [54]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description miR-21 inhibitors induced sensitivity of MCF-7/PR and SkBR-3/PR cells to paclitaxel. And miR-21 mimic can increase the expression of MDR1, Bcl-2/Bax and change cell morphology from parental cells to resistant cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Renal carcinoma [26]
Sensitive Disease Renal carcinoma [ICD-11: 2C90.2]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model 786-O cells Kidney Homo sapiens (Human) CVCL_1051
ACHN cells Pleural effusion Homo sapiens (Human) CVCL_1067
HK-2 cells Kidney Homo sapiens (Human) CVCL_0302
RCC10 cells Kidney Homo sapiens (Human) CVCL_6265
RCC4 cells Kidney Homo sapiens (Human) CVCL_0498
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 Celltiter96 Aqueous Non Radioactive Cell Proliferation Assay
Mechanism Description Tumor suppressor genes like PTEN, PDCD4 and TIMP3, are target genes of miR21. PTEN is a potent inhibitor of PI3k/Akt pathway, as well as a direct target of miR21.
Disease Class: Cervical cancer [55]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
PTEN/AKT signaling pathway Regulation hsa05235
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
Siha cells Cervix uteri Homo sapiens (Human) CVCL_0032
Caski cells Uterus Homo sapiens (Human) CVCL_1100
ME-180 cells Uterus Homo sapiens (Human) CVCL_1401
C33A cells Uterus Homo sapiens (Human) CVCL_1094
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 Annexin V-FITC/PI staining for cell apoptosis assay; Hoechst 33258 staining for cell apoptosis assay; MTT assay
Mechanism Description miR21 inhibitor suppresses cell proliferation and colony formation through regulating the PTEN/AkT pathway and improves paclitaxel sensitivity in cervical cancer cells.
Disease Class: Breast cancer [54]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description miR-21 inhibitors induced sensitivity of MCF-7/PR and SkBR-3/PR cells to paclitaxel. And miR-21 mimic can increase the expression of MDR1, Bcl-2/Bax and change cell morphology from parental cells to resistant cells.
Disease Class: Glioblastoma [56]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
EGFR/STAT3 signaling pathway Inhibition hsa01521
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
LN229 cells Brain Homo sapiens (Human) CVCL_0393
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The miR-21 inhibitor could enhance the chemo-sensitivity of human glioblastoma cells to taxol. A combination of miR-21 inhibitor and taxol could be an effective therapeutic strategy for controlling the growth of GBM by inhibiting STAT3 expression and phosphorylation.
Disease Class: Breast carcinoma [57]
Sensitive Disease Breast carcinoma [ICD-11: 2C60.2]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT signaling pathway Inhibition hsa04151
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Treatment of the miR-21 inhibitor-transfected cells with the anti-cancer drugs taxol resulted in signifi-cantly reduced cell viability and invasiveness compared with control cells.
Prednisone
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [22]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Sensitive Drug Prednisone
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model CRL2631 cells Bone marrow Homo sapiens (Human) CVCL_3611
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 impacts the PI3k/AkT signaling pathway through the regulation of PTEN, thereby affecting cellular sensitivity to the CHOP chemotherapeutic regimen.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [58]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Sorafenib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT signaling pathway Activation hsa04151
Cell apoptosis Inhibition hsa04210
Cell autophagy Inhibition hsa04140
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description LncRNA SNHG1 contributes to sorafenib resistance by activating the Akt pathway and its nuclear expression is promoted by miR-21, whose nuclear translocation is induced by sorafenib.
Tamoxifen
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [39]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Tamoxifen
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
PI3K/AKT/mTOR signaling pathway Regulation hsa04151
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 is a miRNA that is overexpressed in most tumor types, and acts as an oncogene by targeting many suppressor genes related to proliferation, apoptosis, and invasion. miR-21 facilitates tumor growth and invasion by targeting programmed cell death 4 (PDCD4), PTEN, and Bcl-2. silencing of miR-21 sensitized ER+ breast cancer cells to TAM and FUL induced cell apoptosis.
Temozolomide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [59]
Resistant Disease Glioblastoma [ICD-11: 2A00.02]
 Disease Info 
Resistant Drug Temozolomide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
In Vitro Model U87-MG cells Brain Homo sapiens (Human) CVCL_0022
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Trypan blue dye exclusion assay
Mechanism Description miR-21 could inhibit TMZ-induced apoptosis in U87MG cells, at least in part, by decreasing Bax/Bcl-2 ratio and caspase-3 activity.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [60]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
 Disease Info 
Sensitive Drug Temozolomide
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model D54MG cells Brain Homo sapiens (Human) CVCL_5735
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 TUNEL Analysis
Mechanism Description miR-21 is anti-apoptotic, and may promote glioma invasion and proliferation.
Teniposide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [61]
Resistant Disease Glioblastoma [ICD-11: 2A00.02]
 Disease Info 
Resistant Drug Teniposide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
NF-kappaB signaling pathway Activation hsa04064
In Vitro Model U373 MG cells Brain Homo sapiens (Human) CVCL_2219
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 likely contributes to VM-26 resistance through depression of the expression of LRRFIP1, leading to the reduction of the cytotoxicity of chemotherapy drugs through activation of the NF-kB pathway.
Topotecan
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Renal cell carcinoma [62]
Sensitive Disease Renal cell carcinoma [ICD-11: 2C90.0]
 Disease Info 
Sensitive Drug Topotecan
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell colony Inhibition hsa05200
Cell viability Inhibition hsa05200
In Vitro Model A498 cells Kidney Homo sapiens (Human) CVCL_1056
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 XTT assay
Mechanism Description Inhibition of miR-21 rescues PDCD4 and PTEN protein levels and improves chemosensitivity and therapeutic response.
Trastuzumab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [63]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Trastuzumab
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PI3K signaling pathway Activation hsa04151
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description A target prediction analysis coupled with in vitro and in vivo validations revealed that miR-21 levels inversely correlated with the expression of PTEN and PDCD4, which differentially influenced the drug sensitivity of HER2-positive breast cancer cells.miR-21 was able to affect the response to both trastuzumab and chemotherapy, triggering an IL-6/STAT3/NF-kB-mediated signaling loop and activating the PI3k pathway. These findings support the ability of miR-21 signaling to sustain EMT and shape the tumor immune microenvironment in HER2-positive breast cancer.
Disease Class: Gastric cancer [64]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Trastuzumab
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
miR21/PTEN signaling pathway Activation hsa05206
In Vitro Model NCI-N87 cells Gastric Homo sapiens (Human) CVCL_1603
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
NUGC4 cells Gastric Homo sapiens (Human) CVCL_3082
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description The miR-21/PTEN pathway regulated the sensitivity of HER2-positive GC cell lines to trastuzumab through modulation apoptosis.
Disease Class: Breast cancer [65]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Trastuzumab
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation AKT signaling pathway Activation hsa04151
Cell proliferation Activation hsa05200
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
BT474 cells Breast Homo sapiens (Human) CVCL_0179
MDA-MB-453 cells Breast Homo sapiens (Human) CVCL_0418
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR; Northern blotting analysis
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description PTEN is a tumor suppressing dual phosphatase that antagonizes the function of phosphatidylinositol 3-kinase (PI3k) and negatively regulates AkT activities, and PTEN phosphorylation is a crucial mechanism mediating the anti-tumor effect of trastuzumab by reducing and inhibiting the ErbB2 receptor-bound SRC. Ectopic expression of miR-21 in the previously sensitive cells confers trastuzumab resistance via PTEN inhibition.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [22]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Sensitive Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model CRL2631 cells Bone marrow Homo sapiens (Human) CVCL_3611
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-21 impacts the PI3k/AkT signaling pathway through the regulation of PTEN, thereby affecting cellular sensitivity to the CHOP chemotherapeutic regimen.
Curcumin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [66]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Curcumin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Transwell migration assay; Flow cytometric analysis
Mechanism Description Up-regulation of miR21 decreases chemotherapeutic effect of dendrosomal curcumin in breast cancer cells. miR21 decreased apoptotic cells and increased cell migration capacity.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Betulinic acid
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [67]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Resistant Drug Betulinic acid
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
p53/p66shc/miR21-Sod2 signaling pathway Regulation hsa05206
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; TUNEL assay; Promega
Mechanism Description p53 is responsible for the anti-tumor effect of betulinic acid through up-regulation of p66(shc) and miR-21 and down-regulation of Sod2 expression, leading to mitochondrial ROS accumulation and apoptosis.
References
Ref 1 miRNA-21 regulates arsenic-induced anti-leukemia activity in myelogenous cell lines. Med Oncol. 2011 Mar;28(1):211-8. doi: 10.1007/s12032-009-9413-7. Epub 2010 Feb 9.
Ref 2 Anti-miR-21 oligonucleotide sensitizes leukemic K562 cells to arsenic trioxide by inducing apoptosis. Cancer Sci. 2010 Apr;101(4):948-54. doi: 10.1111/j.1349-7006.2010.01489.x. Epub 2010 Jan 7.
Ref 3 MiR-21 enhanced glioma cells resistance to carmustine via decreasing Spry2 expression. Eur Rev Med Pharmacol Sci. 2017 Nov;21(22):5065-5071. doi: 10.26355/eurrev_201711_13819.
Ref 4 Growth arrest-specific 5 attenuates cisplatin-induced apoptosis in cervical cancer by regulating STAT3 signaling via miR-21. J Cell Physiol. 2019 Jun;234(6):9605-9615. doi: 10.1002/jcp.27647. Epub 2018 Oct 23.
Ref 5 miRNA-21 enhances chemoresistance to cisplatin in epithelial ovarian cancer by negatively regulating PTEN. Oncol Lett. 2017 Aug;14(2):1807-1810. doi: 10.3892/ol.2017.6324. Epub 2017 Jun 7.
Ref 6 GAS5 knockdown reduces the chemo-sensitivity of non-small cell lung cancer (NSCLC) cell to cisplatin (DDP) through regulating miR-21/PTEN axis. Biomed Pharmacother. 2017 Sep;93:570-579. doi: 10.1016/j.biopha.2017.06.089. Epub 2017 Jul 4.
Ref 7 Effect of microRNA-21 on multidrug resistance reversal in A549/DDP human lung cancer cells. Mol Med Rep. 2015 Jan;11(1):682-90. doi: 10.3892/mmr.2014.2662. Epub 2014 Oct 15.
Ref 8 Upregulation of miR-21 in cisplatin resistant ovarian cancer via JNK-1/c-Jun pathway. PLoS One. 2014 May 27;9(5):e97094. doi: 10.1371/journal.pone.0097094. eCollection 2014.
Ref 9 MiRNA-21: a biomarker predictive for platinum-based adjuvant chemotherapy response in patients with non-small cell lung cancer. Cancer Biol Ther. 2012 Mar;13(5):330-40. doi: 10.4161/cbt.19073. Epub 2012 Mar 1.
Ref 10 MicroRNA-21 (miR-21) expression promotes growth, metastasis, and chemo- or radioresistance in non-small cell lung cancer cells by targeting PTEN. Mol Cell Biochem. 2013 Jan;372(1-2):35-45. doi: 10.1007/s11010-012-1443-3. Epub 2012 Sep 6.
Ref 11 MiR-21 modulates chemosensitivity of tongue squamous cell carcinoma cells to cisplatin by targeting PDCD4. Mol Cell Biochem. 2014 May;390(1-2):253-62. doi: 10.1007/s11010-014-1976-8. Epub 2014 Mar 11.
Ref 12 The inhibition of miR-21 promotes apoptosis and chemosensitivity in ovarian cancer. Gynecol Oncol. 2014 Mar;132(3):739-44. doi: 10.1016/j.ygyno.2014.01.034. Epub 2014 Jan 25.
Ref 13 miR-21 confers cisplatin resistance in gastric cancer cells by regulating PTEN. Toxicology. 2013 Apr 5;306:162-8. doi: 10.1016/j.tox.2013.02.014. Epub 2013 Mar 4.
Ref 14 Micro-RNA-21 regulates the sensitivity to cisplatin in human neuroblastoma cells. J Pediatr Surg. 2012 Oct;47(10):1797-805. doi: 10.1016/j.jpedsurg.2012.05.013.
Ref 15 MicroRNAs contribute to the chemoresistance of cisplatin in tongue squamous cell carcinoma lines. Oral Oncol. 2010 Apr;46(4):317-22. doi: 10.1016/j.oraloncology.2010.02.002. Epub 2010 Mar 9.
Ref 16 Exosomal transfer of tumor-associated macrophage-derived miR-21 confers cisplatin resistance in gastric cancer cells. J Exp Clin Cancer Res. 2017 Apr 13;36(1):53. doi: 10.1186/s13046-017-0528-y.
Ref 17 Modulation of CASC2/miR-21/PTEN pathway sensitizes cervical cancer to cisplatin. Arch Biochem Biophys. 2017 Jun 1;623-624:20-30. doi: 10.1016/j.abb.2017.05.001. Epub 2017 May 8.
Ref 18 Downregulation of miR-21 increases cisplatin sensitivity of non-small-cell lung cancer. Cancer Genet. 2014 May;207(5):214-20. doi: 10.1016/j.cancergen.2014.04.003. Epub 2014 Apr 13.
Ref 19 [The effect and mechanism of microRNA-21 on cis-dichlorodiamineplatinum resistance in lung cancer cell strain]. Zhonghua Yi Xue Za Zhi. 2016 May 17;96(18):1454-8. doi: 10.3760/cma.j.issn.0376-2491.2016.18.014.
Ref 20 MicroRNA-21 Increases Proliferation and Cisplatin Sensitivity of Osteosarcoma-Derived Cells. PLoS One. 2016 Aug 11;11(8):e0161023. doi: 10.1371/journal.pone.0161023. eCollection 2016.
Ref 21 miR-21 inhibitor sensitizes human OSCC cells to cisplatin. Mol Biol Rep. 2012 May;39(5):5481-5. doi: 10.1007/s11033-011-1350-9. Epub 2012 Jan 15.
Ref 22 MicroRNA-21 regulates the sensitivity of diffuse large B-cell lymphoma cells to the CHOP chemotherapy regimen. Int J Hematol. 2013 Feb;97(2):223-31. doi: 10.1007/s12185-012-1256-x. Epub 2012 Dec 30.
Ref 23 Anti-miR-21 oligonucleotide enhances chemosensitivity of leukemic HL60 cells to arabinosylcytosine by inducing apoptosis. Hematology. 2010 Aug;15(4):215-21. doi: 10.1179/102453310X12647083620840.
Ref 24 Involvement of miR-21 in resistance to daunorubicin by regulating PTEN expression in the leukaemia K562 cell line. FEBS Lett. 2011 Jan 21;585(2):402-8. doi: 10.1016/j.febslet.2010.12.027. Epub 2010 Dec 25.
Ref 25 Involvement of microRNA-21 in mediating chemo-resistance to docetaxel in androgen-independent prostate cancer PC3 cells. Acta Pharmacol Sin. 2010 Jul;31(7):867-73. doi: 10.1038/aps.2010.48. Epub 2010 Jun 28.
Ref 26 Targeting miR-21 decreases expression of multi-drug resistant genes and promotes chemosensitivity of renal carcinoma. Tumour Biol. 2017 Jul;39(7):1010428317707372. doi: 10.1177/1010428317707372.
Ref 27 Triptolide modulates the sensitivity of K562/A02 cells to adriamycin by regulating miR-21 expression. Pharm Biol. 2012 Oct;50(10):1233-40. doi: 10.3109/13880209.2012.665931.
Ref 28 MicroRNA-21 modulates chemosensitivity of breast cancer cells to doxorubicin by targeting PTEN. Arch Med Res. 2011 May;42(4):281-90. doi: 10.1016/j.arcmed.2011.06.008.
Ref 29 microRNA-21 modulates cell proliferation and sensitivity to doxorubicin in bladder cancer cells. Oncol Rep. 2011 Jun;25(6):1721-9. doi: 10.3892/or.2011.1245. Epub 2011 Apr 4.
Ref 30 Anti-miR21 oligonucleotide enhances chemosensitivity of T98G cell line to doxorubicin by inducing apoptosis. Am J Cancer Res. 2014 Dec 15;5(1):231-42. eCollection 2015.
Ref 31 Hyaluronan-CD44 interaction promotes c-Jun signaling and miRNA21 expression leading to Bcl-2 expression and chemoresistance in breast cancer cells. Mol Cancer. 2014 Mar 8;13:52. doi: 10.1186/1476-4598-13-52.
Ref 32 MicroRNA-21 induces 5-fluorouracil resistance in human pancreatic cancer cells by regulating PTEN and PDCD4. Cancer Med. 2016 Apr;5(4):693-702. doi: 10.1002/cam4.626. Epub 2016 Feb 10.
Ref 33 [Drug resistance of colon cancer cells to 5-fluorouracil mediated by microRNA-21]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2015 Oct;32(5):620-4. doi: 10.3760/cma.j.issn.1003-9406.2015.05.003.
Ref 34 High miR-21 expression from FFPE tissues is associated with poor survival and response to adjuvant chemotherapy in colon cancer. Int J Cancer. 2014 Apr 15;134(8):1926-34. doi: 10.1002/ijc.28522. Epub 2013 Nov 8.
Ref 35 Targeting miR-21 enhances the sensitivity of human colon cancer HT-29 cells to chemoradiotherapy in vitro. Biochem Biophys Res Commun. 2014 Jan 17;443(3):789-95. doi: 10.1016/j.bbrc.2013.11.064. Epub 2013 Nov 23.
Ref 36 MicroRNA-21 induces resistance to 5-fluorouracil by down-regulating human DNA MutS homolog 2 (hMSH2). Proc Natl Acad Sci U S A. 2010 Dec 7;107(49):21098-103. doi: 10.1073/pnas.1015541107. Epub 2010 Nov 15.
Ref 37 MicroRNA-21 induces resistance to the anti-tumour effect of interferon-Alpha/5-fluorouracil in hepatocellular carcinoma cells. Br J Cancer. 2010 Nov 9;103(10):1617-26. doi: 10.1038/sj.bjc.6605958. Epub 2010 Oct 26.
Ref 38 Identification of microRNA-21 as a biomarker for chemoresistance and clinical outcome following adjuvant therapy in resectable pancreatic cancer. PLoS One. 2010 May 14;5(5):e10630. doi: 10.1371/journal.pone.0010630.
Ref 39 Silencing of MicroRNA-21 confers the sensitivity to tamoxifen and fulvestrant by enhancing autophagic cell death through inhibition of the PI3K-AKT-mTOR pathway in breast cancer cells. Biomed Pharmacother. 2016 Feb;77:37-44. doi: 10.1016/j.biopha.2015.11.005. Epub 2015 Dec 12.
Ref 40 Alteration in Mir-21/PTEN expression modulates gefitinib resistance in non-small cell lung cancer. PLoS One. 2014 Jul 24;9(7):e103305. doi: 10.1371/journal.pone.0103305. eCollection 2014.
Ref 41 MiR-21 overexpression is associated with acquired resistance of EGFR-TKI in non-small cell lung cancer. Lung Cancer. 2014 Feb;83(2):146-53. doi: 10.1016/j.lungcan.2013.11.003. Epub 2013 Nov 13.
Ref 42 MicroRNA-21 in pancreatic cancer: correlation with clinical outcome and pharmacologic aspects underlying its role in the modulation of gemcitabine activity. Cancer Res. 2010 Jun 1;70(11):4528-38. doi: 10.1158/0008-5472.CAN-09-4467. Epub 2010 May 11.
Ref 43 Bcl-2 upregulation induced by miR-21 via a direct interaction is associated with apoptosis and chemoresistance in MIA PaCa-2 pancreatic cancer cells. Arch Med Res. 2011 Jan;42(1):8-14. doi: 10.1016/j.arcmed.2011.01.006.
Ref 44 The serum miR-21 level serves as a predictor for the chemosensitivity of advanced pancreatic cancer, and miR-21 expression confers chemoresistance by targeting FasL. Mol Oncol. 2013 Jun;7(3):334-45. doi: 10.1016/j.molonc.2012.10.011. Epub 2012 Nov 7.
Ref 45 MiR-21 upregulation induced by promoter zone histone acetylation is associated with chemoresistance to gemcitabine and enhanced malignancy of pancreatic cancer cells. Asian Pac J Cancer Prev. 2013;14(12):7529-36. doi: 10.7314/apjcp.2013.14.12.7529.
Ref 46 Gemcitabine resistance in pancreatic ductal adenocarcinoma .Drug Resist Updat. 2015 Nov;23:55-68. doi: 10.1016/j.drup.2015.10.002. Epub 2015 Nov 3. 10.1016/j.drup.2015.10.002
Ref 47 Micro-RNA-21 Regulates Cancer-Associated Fibroblast-Mediated Drug Resistance in Pancreatic Cancer. Oncol Res. 2018 Jul 5;26(6):827-835. doi: 10.3727/096504017X14934840662335. Epub 2017 May 5.
Ref 48 p85Alpha is a microRNA target and affects chemosensitivity in pancreatic cancer. J Surg Res. 2015 Jun 15;196(2):285-293. doi: 10.1016/j.jss.2015.02.071. Epub 2015 Mar 6.
Ref 49 MicroRNA-21 modulates biological functions of pancreatic cancer cells including their proliferation, invasion, and chemoresistance. Mol Cancer Ther. 2009 May;8(5):1067-74. doi: 10.1158/1535-7163.MCT-08-0592. Epub 2009 May 12.
Ref 50 Involvement of human micro-RNA in growth and response to chemotherapy in human cholangiocarcinoma cell lines. Gastroenterology. 2006 Jun;130(7):2113-29. doi: 10.1053/j.gastro.2006.02.057.
Ref 51 miRNA-21 sensitizes gastrointestinal stromal tumors (GISTs) cells to Imatinib via targeting B-cell lymphoma 2 (Bcl-2). Eur Rev Med Pharmacol Sci. 2016 Sep;20(17):3574-81.
Ref 52 LncRNA MEG3 Regulates Imatinib Resistance in Chronic Myeloid Leukemia via Suppressing MicroRNA-21. Biomol Ther (Seoul). 2017 Sep 1;25(5):490-496. doi: 10.4062/biomolther.2016.162.
Ref 53 Exosomal transfer of stroma-derived miR21 confers paclitaxel resistance in ovarian cancer cells through targeting APAF1. Nat Commun. 2016 Mar 29;7:11150. doi: 10.1038/ncomms11150.
Ref 54 [Effects of miRNA-21 on paclitaxel-resistance in human breast cancer cells]. Zhejiang Da Xue Xue Bao Yi Xue Ban. 2015 Jul;44(4):400-9. doi: 10.3785/j.issn.1008-9292.2015.07.09.
Ref 55 miR-21 inhibitor suppresses cell proliferation and colony formation through regulating the PTEN/AKT pathway and improves paclitaxel sensitivity in cervical cancer cells. Mol Med Rep. 2017 May;15(5):2713-2719. doi: 10.3892/mmr.2017.6340. Epub 2017 Mar 16.
Ref 56 MicroRNA-21 inhibitor sensitizes human glioblastoma cells U251 (PTEN-mutant) and LN229 (PTEN-wild type) to taxol. BMC Cancer. 2010 Jan 31;10:27. doi: 10.1186/1471-2407-10-27.
Ref 57 Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.
Ref 58 LncRNA SNHG1 contributes to sorafenib resistance by activating the Akt pathway and is positively regulated by miR-21 in hepatocellular carcinoma cells. J Exp Clin Cancer Res. 2019 May 3;38(1):183. doi: 10.1186/s13046-019-1177-0.
Ref 59 MiR-21 protected human glioblastoma U87MG cells from chemotherapeutic drug temozolomide induced apoptosis by decreasing Bax/Bcl-2 ratio and caspase-3 activity. Brain Res. 2010 Sep 17;1352:255-64. doi: 10.1016/j.brainres.2010.07.009. Epub 2010 Jul 13.
Ref 60 MicroRNA-21 inhibition enhances in vitro chemosensitivity of temozolomide-resistant glioblastoma cells. Anticancer Res. 2012 Jul;32(7):2835-41.
Ref 61 MicroRNA-21 targets LRRFIP1 and contributes to VM-26 resistance in glioblastoma multiforme. Brain Res. 2009 Aug 25;1286:13-8. doi: 10.1016/j.brainres.2009.06.053. Epub 2009 Jun 24.
Ref 62 Small Molecule Inhibition of MicroRNA miR-21 Rescues Chemosensitivity of Renal-Cell Carcinoma to Topotecan. J Med Chem. 2018 Jul 26;61(14):5900-5909. doi: 10.1021/acs.jmedchem.7b01891. Epub 2018 Jul 11.
Ref 63 MicroRNA-21 links epithelial-to-mesenchymal transition and inflammatory signals to confer resistance to neoadjuvant trastuzumab and chemotherapy in HER2-positive breast cancer patients. Oncotarget. 2015 Nov 10;6(35):37269-80. doi: 10.18632/oncotarget.5495.
Ref 64 The microRNA-21/PTEN pathway regulates the sensitivity of HER2-positive gastric cancer cells to trastuzumab. Ann Surg Oncol. 2014 Jan;21(1):343-50. doi: 10.1245/s10434-013-3325-7. Epub 2013 Oct 24.
Ref 65 Up-regulation of miR-21 mediates resistance to trastuzumab therapy for breast cancer. J Biol Chem. 2011 May 27;286(21):19127-37. doi: 10.1074/jbc.M110.216887. Epub 2011 Apr 6.
Ref 66 Up-regulation of miR-21 decreases chemotherapeutic effect of dendrosomal curcumin in breast cancer cells. Iran J Basic Med Sci. 2017 Apr;20(4):350-359. doi: 10.22038/IJBMS.2017.8574.
Ref 67 p53-p66(shc)/miR-21-Sod2 signaling is critical for the inhibitory effect of betulinic acid on hepatocellular carcinoma. Toxicol Lett. 2015 Nov 4;238(3):1-10. doi: 10.1016/j.toxlet.2015.07.016. Epub 2015 Jul 26.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.