Molecule Information

General Information of the Molecule (ID: Mol01336)

• Name: hsa-mir-16 ,Homo sapiens
• Synonyms: microRNA 16-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR16-1
• Gene ID: 406950
• Location: chr13:50048973-50049061[-]
• Sequence:
  GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGU
  AUUAACUGUGCUGCUGAAGUAAGGUUGAC
• Ensembl ID: ENSG00000208006
• HGNC ID: HGNC:31545
• Precursor Accession: MI0000070

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 11 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant pleural mesothelioma [1]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SYBR Green-based assay
• Mechanism Description: Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.

Disease Class: Malignant pleural mesothelioma [1]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SYBR Green-based assay
• Mechanism Description: Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epidermoid carcinoma [2]

• Sensitive Disease: Epidermoid carcinoma [ICD-11: 2C31.Z]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: KB-3-1 cells; Lung; Homo sapiens (Human); CVCL_2088
• In Vitro Model: KB-CP.5 cells; Lung; Homo sapiens (Human); CVCL_IP04
• In Vitro Model: KB-CP20 cells; Lung; Homo sapiens (Human); CVCL_IP06
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of the cell cycle kinases WEE1 and CHk1 occurred commonly in cisplatin-resistant cells, miR-15/16/195/424/497 family sensitize cisplatin-resistant cells to apoptosis by targeting WEE1 and CHk1.

Disease Class: Gastric cancer [3]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Mitochondrial signaling pathway; Activation; hsa04217
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.

Dexamethasone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Multiple myeloma [4]

• Resistant Disease: Multiple myeloma [ICD-11: 2A83.0]
• Resistant Drug: Dexamethasone
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: microRNA-15a and -16 expressions tightly correlated with proliferation and drug sensitivity of MM cells. miRNA-15a/-16 expression in MM cells was significantly increased after treatment with cytotoxic agents. The interaction of bone marrow stromal cells (BMSC) with MM cells resulted in decreased miRNA-15a/-16 expression and promoted the survival of the MM cells.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [5]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/AR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Transwell invasion assay; CCK8 assay
• Mechanism Description: The expression of miR16-1 was positively related with the chemosensitivity of GC to adriamycin, and miR16-1 could targeted silence FUBP1 to advance the chemosensitivity to adriamycin in GC.

Disease Class: Gastric cancer [3]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Mitochondrial signaling pathway; Activation; hsa04217
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [3]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Mitochondrial signaling pathway; Activation; hsa04217
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant pleural mesothelioma [6]

• Sensitive Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MET-5A cells; Lung; Homo sapiens (Human); CVCL_3749
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay
• Mechanism Description: Growth inhibition caused by miR-16 correlated with downregulation of target genes including Bcl-2 and CCND1, and miR-16 re-expression sensitised MPM cells to pemetrexed and gemcitabine.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [7]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: LncRNA UCA1 Contributes to Imatinib Resistance by Acting as a ceRNA Against miR16 in Chronic Myeloid Leukemia Cells. UCA1 directly interacts with miR16.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [8]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: NF-kappaB signaling pathway; Activation; hsa04064
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: HCCLM3 cells; Liver; Homo sapiens (Human); CVCL_6832
• In Vitro Model: BEL-7404 cells; Liver; Homo sapiens (Human); CVCL_6568
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: PLC cells; Liver; Homo sapiens (Human); CVCL_0485
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Silencing the expression of miR-16 induced the chemoresistance in HCC by target IkBkB via NF-kB signaling pathway.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [9]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: NF-kappaB signaling pathway; Regulation; hsa04064
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Ectopic expression of miR-16 promoted Taxol-induced cytotoxicity and apoptosis in breast cancer cells. Furthermore, IkBkB was identified to be a direct target of miR-16, restoring the expression of IkBkB counteracted miR-16-mediated Taxol sensitivity. Moreover, miR-16 was highly expressed in Taxol-sensitive breast cancer patients and negatively associated with T stages, whereas IkBkB was lowly expressed in Taxol-sensitive breast cancer and positively correlated with T, N and clinical stages.

Disease Class: Lung cancer [10]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: PI3K/AKT/mTOR signaling pathway; Regulation; hsa04151
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCl-H596 cells; Lung; Homo sapiens (Human); CVCL_1571
• In Vitro Model: NCI-H1734 cells; Lung; Homo sapiens (Human); CVCL_1491
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-16 was also significantly downregulated in paclitaxel resistant lung cancer cells. anti-apoptotic protein Bcl-2 was directly targeted miR-16 in paclitaxel resistant lung cancer cells. the combined overexpression of miR-16 and miR-17 and subsequent paclitaxel treatment greatly sensitized paclitaxel resistant lung cancer cells to paclitaxel by inducing apoptosis via caspase-3 mediated pathway. Combined overexpression of miR-16 and miR-17 greatly reduced Beclin-1 and Bcl-2 expressions respectively. though miR-17 and miR-16 had no common target, both miR-16 and miR-17 jointly played roles in the development of paclitaxel resistance in lung cancer. miR-17 overexpression reduced cytoprotective autophagy by targeting Beclin-1, whereas overexpression of miR-16 potentiated paclitaxel induced apoptotic cell death by inhibiting anti-apoptotic protein Bcl-2.

Pemetrexed

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant pleural mesothelioma [6]

• Sensitive Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Sensitive Drug: Pemetrexed
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MET-5A cells; Lung; Homo sapiens (Human); CVCL_3749
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay
• Mechanism Description: Growth inhibition caused by miR-16 correlated with downregulation of target genes including Bcl-2 and CCND1, and miR-16 re-expression sensitised MPM cells to pemetrexed and gemcitabine.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [11]

• Resistant Disease: Glioma [ICD-11: 2A00.1]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: A172 cells; Brain; Homo sapiens (Human); CVCL_0131
• In Vitro Model: U138-MG cells; Brain; Homo sapiens (Human); CVCL_0020
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: The mechanism responsible for resistance of glioma cells to temozolomide was associated with miR-16-mediated downregulation of Bcl-2. miR-16 may function as an important modifier of the response of glioma cells to temozolomide.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [12]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-15a and Mir-16 reverse drug resistance in colon cancer cells, possibly by down-regulating the expression of Bcl-2 protein.

Disease Class: Gastric cancer [3]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Mitochondrial signaling pathway; Activation; hsa04217
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.

Vinorelbine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant pleural mesothelioma [1]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Vinorelbine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SYBR Green-based assay
• Mechanism Description: Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.

Disease Class: Malignant pleural mesothelioma [1]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Vinorelbine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: SYBR Green-based assay
• Mechanism Description: Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.

References

• Ref 1: Tumour suppressor microRNAs contribute to drug resistance in malignant pleural mesothelioma by targeting anti-apoptotic pathways .Cancer Drug Resist. 2019 Dec 19;2(4):1193-1206. doi: 10.20517/cdr.2019.41. eCollection 2019. 10.20517/cdr.2019.41
• Ref 2: Cisplatin sensitivity mediated by WEE1 and CHK1 is mediated by miR-155 and the miR-15 family. Cancer Res. 2012 Nov 15;72(22):5945-55. doi: 10.1158/0008-5472.CAN-12-1400. Epub 2012 Aug 31.
• Ref 3: miR-15b and miR-16 modulate multidrug resistance by targeting BCL2 in human gastric cancer cells. Int J Cancer. 2008 Jul 15;123(2):372-379. doi: 10.1002/ijc.23501.
• Ref 4: Suppressing miRNA-15a/-16 expression by interleukin-6 enhances drug-resistance in myeloma cells. J Hematol Oncol. 2011 Sep 22;4:37. doi: 10.1186/1756-8722-4-37.
• Ref 5: MiR-16-1 Targeted Silences Far Upstream Element Binding Protein 1 to Advance the Chemosensitivity to Adriamycin in Gastric Cancer. Pathol Oncol Res. 2018 Jul;24(3):483-488. doi: 10.1007/s12253-017-0263-x. Epub 2017 Jun 30.
• Ref 6: Restoring expression of miR-16: a novel approach to therapy for malignant pleural mesothelioma. Ann Oncol. 2013 Dec;24(12):3128-35. doi: 10.1093/annonc/mdt412. Epub 2013 Oct 22.
• Ref 7: lncRNA UCA1 Contributes to Imatinib Resistance by Acting as a ceRNA Against miR-16 in Chronic Myeloid Leukemia Cells. DNA Cell Biol. 2017 Jan;36(1):18-25. doi: 10.1089/dna.2016.3533. Epub 2016 Nov 17.
• Ref 8: Inhibition of microRNA-16 facilitates the paclitaxel resistance by targeting IKBKB via NF-kB signaling pathway in hepatocellular carcinoma. Biochem Biophys Res Commun. 2018 Sep 5;503(2):1035-1041. doi: 10.1016/j.bbrc.2018.06.113. Epub 2018 Aug 2.
• Ref 9: MicroRNA-16 sensitizes breast cancer cells to paclitaxel through suppression of IKBKB expression. Oncotarget. 2016 Apr 26;7(17):23668-83. doi: 10.18632/oncotarget.8056.
• Ref 10: MiR-16 targets Bcl-2 in paclitaxel-resistant lung cancer cells and overexpression of miR-16 along with miR-17 causes unprecedented sensitivity by simultaneously modulating autophagy and apoptosis. Cell Signal. 2015 Feb;27(2):189-203. doi: 10.1016/j.cellsig.2014.11.023. Epub 2014 Nov 27.
• Ref 11: MiR-16 modulate temozolomide resistance by regulating BCL-2 in human glioma cells. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12698-707. eCollection 2015.
• Ref 12: [miR-15a and miR-16 modulate drug resistance by targeting bcl-2 in human colon cancer cells]. Zhonghua Zhong Liu Za Zhi. 2014 Dec;36(12):897-902.