Molecule Information

General Information of the Molecule (ID: Mol01328)

• Name: hsa-let-7a ,Homo sapiens
• Synonyms: microRNA let-7a-1
• Molecule Type: Precursor miRNA
• Gene Name: HCCAT1, LINC00078, NCRNA00078
• Gene ID: 406881
• Location: chr9:94175957-94176036[+]
• Sequence:
  UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAU
  ACAAUCUACUGUCUUUCCUA
• Ensembl ID: ENSG00000199165
• HGNC ID: HGNC:31476
• Precursor Accession: MI0000060

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 10 drug(s) in total

Cetuximab

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Cetuximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: SNU449 cells; Liver; Homo sapiens (Human); CVCL_0454
• In Vitro Model: SNU387 cells; Liver; Homo sapiens (Human); CVCL_0250
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Let-7a enhances the sensitivity of hepatocellular carcinoma cells to cetuximab by negatively regulating STAT3 expression.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Nasopharyngeal carcinoma [2]

• Resistant Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell cytotoxicity; Inhibition; hsa04650
• Cell Pathway Regulation: Tumorigenesis; Activation; hsa05206
• In Vitro Model: 5-8F cells; Nasopharynx; Homo sapiens (Human); CVCL_C528
• In Vitro Model: CNE2 cells; Nasopharynx; Homo sapiens (Human); CVCL_6889
• In Vitro Model: CNE1 cells; Throat; Homo sapiens (Human); CVCL_6888
• In Vitro Model: HONE1 cells; Throat; Homo sapiens (Human); CVCL_8706
• In Vitro Model: NP69 cells; Nasopharynx; Homo sapiens (Human); CVCL_F755
• In Vitro Model: S18 cells; Nasopharynx; Homo sapiens (Human); CVCL_B0U9
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: Luciferase reporter assay; RT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin V-FITC apoptosis assay
• Mechanism Description: ANRIL directly interacts with let-7a and regulates its expression, ANRIL could directly bind to let-7a and negatively regulate let-7a expression. Down-regulation of LncRNA ANRIL represses tumorigenicity and enhances cisplatin-induced cytotoxicity via regulating microRNA let-7a in nasopharyngeal carcinoma.

Cytarabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute myeloid leukemia [3]

• Sensitive Disease: Acute myeloid leukemia [ICD-11: 2A60.0]
• Sensitive Drug: Cytarabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell growth; Activation; hsa05200
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Epithelial mesenchymal transition signaling pathway; Activation; hsa01521
• In Vitro Model: Molm13 cells; Blood; Homo sapiens (Human); CVCL_2119
• In Vitro Model: OCI-AML3 cells; Blood; Homo sapiens (Human); CVCL_1844
• In Vivo Model: AML nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Xenografts of primary human AML cells engineered to overexpress let-7a exhibited enhanced sensitivity to cytarabine.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast adenocarcinoma [4]

• Resistant Disease: Breast adenocarcinoma [ICD-11: 2C60.1]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel.

Disease Class: Hepatocellular carcinoma [4]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel.

Disease Class: Cutaneous squamous cell carcinoma [4]

• Resistant Disease: Cutaneous squamous cell carcinoma [ICD-11: 2C31.1]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: A431 cells; Skin; Homo sapiens (Human); CVCL_0037
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [5]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Redox signaling pathway; Regulation; hsa01100
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: WM239 cells; Breast; Homo sapiens (Human); CVCL_6795
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Let-7a represses proliferation and clonogenic capacity of MDA-MB-231 cells. Let-7a down-regulates key anabolic enzymes in MDA-MB-231 cells. Let-7a regulates energy metabolism and mitochondrial ROS in MDA-MB-231 cells. Let-7a regulates mitochondrial ROS in WM239 melanoma cells. Let-7a sensitizes breast cancer and melanoma cells to doxorubicin.

Epirubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [6]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Epirubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Lower let-7a expression was associated with epirubicin resistance in primary breast tumors. Moreover, upregulation of let-7a expression sensitized resistant breast tumor cell lines to epirubicin by enhancing cellular apoptosis in vitro. Collectively, these findings indicate that lower expression of let-7a miRNA can induce chemoresistance in breast cancer by enhancing cellular apoptosis and suggest that let-7a may be used as a therapeutic target to modulate epirubicin-based chemotherapy resistance.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [7]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Transwell assays and wound healing assay; Flow cytometry assay
• Mechanism Description: ANRIL promotes chemoresistance via disturbing expression of ABCC1 by inhibiting the expression of Let-7a in colorectal cancer.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [8]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: CXCR4/let-7a/HMGA2 pathway; Regulation; hsa05206
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HPDE6-C7 cells; Pancreas; Homo sapiens (Human); CVCL_0P38
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Transwell assay; Flow cytometric analysis
• Mechanism Description: CXCR4/Let-7a axis regulates metastasis and chemoresistance of pancreatic cancer cells through targeting HMGA2. overexpression of HMGA2 restores cell proliferation, metastasis and chemosensitivity of gem inhibited by let-7a.

Lamivudine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast adenocarcinoma [4]

• Resistant Disease: Breast adenocarcinoma [ICD-11: 2C60.1]
• Resistant Drug: Lamivudine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel.

Disease Class: Hepatocellular carcinoma [4]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Lamivudine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel.

Disease Class: Cutaneous squamous cell carcinoma [4]

• Resistant Disease: Cutaneous squamous cell carcinoma [ICD-11: 2C31.1]
• Resistant Drug: Lamivudine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: A431 cells; Skin; Homo sapiens (Human); CVCL_0037
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [7]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Transwell assays and wound healing assay; Flow cytometry assay
• Mechanism Description: ANRIL promotes chemoresistance via disturbing expression of ABCC1 by inhibiting the expression of Let-7a in colorectal cancer.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast adenocarcinoma [4]

• Resistant Disease: Breast adenocarcinoma [ICD-11: 2C60.1]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel.

Disease Class: Hepatocellular carcinoma [4]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel.

Disease Class: Cutaneous squamous cell carcinoma [4]

• Resistant Disease: Cutaneous squamous cell carcinoma [ICD-11: 2C31.1]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: A431 cells; Skin; Homo sapiens (Human); CVCL_0037
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Caspase-3 is the key executioner caspase in apoptosis. Ectopic expression of let-7adecreased the luciferase activity of a reporter constructcontaining the 30untranslated region of caspase-3. Enforced let-7aexpression increased the resistance in A431 cells andHepG2 cells to apoptosis induced by therapeutic drugs suchas interferon-gamma, doxorubicin and paclitaxel.

References

• Ref 1: Let-7a enhances the sensitivity of hepatocellular carcinoma cells to cetuximab by regulating STAT3 expression. Onco Targets Ther. 2016 Nov 28;9:7253-7261. doi: 10.2147/OTT.S116127. eCollection 2016.
• Ref 2: Downregulation of lncRNA ANRIL represses tumorigenicity and enhances cisplatin-induced cytotoxicity via regulating microRNA let-7a in nasopharyngeal carcinoma. J Biochem Mol Toxicol. 2017 Jul;31(7). doi: 10.1002/jbt.21904. Epub 2017 Jan 24.
• Ref 3: CXCR4 downregulation of let-7a drives chemoresistance in acute myeloid leukemia. J Clin Invest. 2013 Jun;123(6):2395-407. doi: 10.1172/JCI66553. Epub 2013 May 8.
• Ref 4: Let-7a microRNA suppresses therapeutics-induced cancer cell death by targeting caspase-3. Apoptosis. 2008 Oct;13(10):1215-22. doi: 10.1007/s10495-008-0256-z.
• Ref 5: Metabolic reprogramming of metastatic breast cancer and melanoma by let-7a microRNA. Oncotarget. 2015 Feb 10;6(4):2451-65. doi: 10.18632/oncotarget.3235.
• Ref 6: Reduced Let-7a Is Associated with Chemoresistance in Primary Breast Cancer. PLoS One. 2015 Jul 28;10(7):e0133643. doi: 10.1371/journal.pone.0133643. eCollection 2015.
• Ref 7: ANRIL promotes chemoresistance via disturbing expression of ABCC1 by regulating the expression of Let-7a in colorectal cancer. Biosci Rep. 2018 Nov 20;38(6):BSR20180620. doi: 10.1042/BSR20180620. Print 2018 Dec 21.
• Ref 8: CXCR4/Let-7a Axis Regulates Metastasis and Chemoresistance of Pancreatic Cancer Cells Through Targeting HMGA2. Cell Physiol Biochem. 2017;43(2):840-851. doi: 10.1159/000481610. Epub 2017 Sep 28.