General Information of the Molecule (ID: Mol05990)
Name
hsa-miR-30b-5p ,Homo sapiens
Molecule Type
Mature miRNA
Sequence
UGUAAACAUCCUACACUCAGCU
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
PLX4720
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [1]
Resistant Disease Papillary thyroid carcinoma [ICD-11: 2D10.1]
Resistant Drug PLX4720
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
Immunoblot analysis; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description This gene is up-regulated in PLX4720-resistance cells
References
Ref 1 Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.