Molecule Information

General Information of the Molecule (ID: Mol05972)

Name	hsa-miR-504 ,Homo sapiens
Molecule Type	Precursor miRNA
Sequence	GCUGCUGUUGGGAGACCCUGGUCUGCACUCUAUCUGUAUUCUUACUGAAGGGAGUGCAGG GCAGGGUUUCCCAUACAGAGGGC Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Clinical Trial Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

PLX4720

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)		Click to Show/Hide
Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1]			[1]
Resistant Disease	Papillary thyroid carcinoma [ICD-11: 2D10.1]		Disease Info
Resistant Drug	PLX4720		Drug Info
Molecule Alteration	Expression	Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Experiment for Molecule Alteration	Immunoblot analysis; qRT-PCR
Experiment for Drug Resistance	Flow cytometry assay
Mechanism Description	This gene is down-regulated in PLX4720-resistance cells

References

Ref 1	Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.