Molecule Information

General Information of the Molecule (ID: Mol05961)

• Name: hsa-miR-1323 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence: UCAAAACUGAGGGGCAUUUUCU

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] [1]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.0]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-qPCR
• Mechanism Description: The miRNA profiles within and between non-responders and responders were highly similar (r = 0.96, 0.94 and 0.95). However, 12 miRNAs were differentially expressed (> twofold; p <= 0.025): non-responders showed upregulation of hsa-miR-1323, hsa-miR-3678-3p, hsv2-miR-H7-3p, hsa-miR-194*, hsa-miR-3152, kshv-miR-K12-4-3p, hsa-miR-665 and hsa-miR-3659 and downregulation of hsa-miR-126*, hsa-miR-484, hsa-miR-330-3p and hsa-miR-3653. qRT-PCR analysis confirmed the microarray findings for hsa-miR-194* and hsa-miR-665 (p < 0.001 each) with AUC values of 0.811 (95% CI 0.694-0.927) and 0.817 (95% CI 0.704-0.930), respectively, in ROC analysis.

References

• Ref 1: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.