Molecule Information

General Information of the Molecule (ID: Mol05949)

• Name: hsa-miR-1258 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence: AGUUAGGAUUAGGUCGUGGAA

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MiRNAs differentially expressed in HCT116, HT29 and their oxaliplatin resistance cells. The results manifested has-miR-1258 down-regulated in the HCT116-OxR and HT29-OxR cells.

References

• Ref 1: APC Mutations as a Potential Biomarker for Sensitivity to Tankyrase Inhibitors in Colorectal CancerMol Cancer Ther. 2017 Apr;16(4):752-762. doi: 10.1158/1535-7163.MCT-16-0578. Epub 2017 Feb 8.