Molecule Information

General Information of the Molecule (ID: Mol05912)

• Name: hsa-miR-325 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence: CCUAGUAGGUGUCCAGUAAGUGU

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [ICD-11: 2C94.0] [1]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• In Vitro Model: RT4 cells; Bladder; Homo sapiens (Human); CVCL_0036
• In Vitro Model: 5637 cells; Bladder; Homo sapiens (Human); CVCL_0126
• In Vitro Model: HT-1376 cells; Urinary bladder; Homo sapiens (Human); CVCL_1292
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: UM-UC-3 cells; Bladder; Homo sapiens (Human); CVCL_1783
• In Vitro Model: TCCSuP cells; Bladder; Homo sapiens (Human); CVCL_1738
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Human microRNA-325 was aberrantly downregulated in both bladder cell lines and human bladder carcinomas. Lowly expressed human microRNA-325 in bladder carcinoma was closely associated with poor postoperative overall survival of patients with cancer. In T24 and 5637 cells, virally transduced cells had markedly upregulated human microRNA-325 expressions. Biochemical assays demonstrated that human microRNA-325 upregulation in bladder cancer had tumor-suppressive functions by decreasing cancer proliferation, cisplatin chemoresistance, and cancer migration in vitro and hindering transplantation growth in vivo and cell cycle transition.

References

• Ref 1: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.