Molecule Information

General Information of the Molecule (ID: Mol05911)

• Name: hsa-miR-492 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence: AGGACCUGCGGGACAAGAUUCUU

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [ICD-11: 2C77.0] [1]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: C33A cells; Uterus; Homo sapiens (Human); CVCL_1094
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: RT-qPCR; Western blot; ChIP assay; Firefly dual-luciferase reporter assay
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: In cervical cancer cells, p53 activated miR-492 expression transcriptionally.

References

• Ref 1: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.