Molecule Information

General Information of the Molecule (ID: Mol05875)

• Name: hsa-miR-891a ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  CCUUAAUCCUUGCAACGAACCUGAGCCACUGAUUCAGUAAAAUACUCAGUGGCACAUGUU
  UGUUGUGAGGGUCAAAAGA

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

References

• Ref 1: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.