Molecule Information
General Information of the Molecule (ID: Mol05867)
| Name |
hsa-miR-627
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Molecule Type |
Precursor miRNA
|
||||
| Sequence |
UACUUAUUACUGGUAGUGAGUCUCUAAGAAAAGAGGAGGUGGUUGUUUUCCUCCUCUUUU
CUUUGAGACUCACUACCAAUAAUAAGAAAUACUACUA Click to Show/Hide
|
||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] | [1] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.0] | |||
| Resistant Drug | Sorafenib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 | |
| Experiment for Molecule Alteration |
RT-PCR; Western blot; Luciferase assay | |||
| Experiment for Drug Resistance |
Cytotoxicity assay; Apoptosis assays | |||
| Mechanism Description | Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
