General Information of the Molecule (ID: Mol05867)
Name
hsa-miR-627 ,Homo sapiens
Molecule Type
Precursor miRNA
Sequence
UACUUAUUACUGGUAGUGAGUCUCUAAGAAAAGAGGAGGUGGUUGUUUUCCUCCUCUUUU
CUUUGAGACUCACUACCAAUAAUAAGAAAUACUACUA
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [1]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
Resistant Drug Sorafenib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration
RT-PCR; Western blot; Luciferase assay
Experiment for
Drug Resistance
Cytotoxicity assay; Apoptosis assays
Mechanism Description Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.
References
Ref 1 Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.