General Information of the Molecule (ID: Mol05823)
Name
hsa-miR-518d-3p ,Homo sapiens
Molecule Type
Mature miRNA
Sequence
CAAAGCGCUUCCCUUUGGAGC
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Etoposide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [1]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Etoposide
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
qRT-PCR, Reverse Transcription and Running ABC Transporter TLDA
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Using miRNA microfluidic arrays from ABI, we determined the microRNA profile for MCF7VP cells compared to drug sensitive cells. Multiple miRNAs showed differential expression among the cell lines including hsa-miR-382, hsa-miR-23b and hsa-miR-885-5p, which were up-regulated (>2-fold increase) in MCF7VP cells and hsa-mir-218, hsa-miR-758 and hsa-miR-548d-5p, which were down-regulated (>2-fold decrease) in MCF7VP cells, suggesting that etoposide resistant MCF7 cells have a miRNA profile that is distinct from the MCF7 drug sensitive cell line.
References
Ref 1 Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.