Molecule Information

General Information of the Molecule (ID: Mol05817)

• Name: hsa-miR-744 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  UUGGGCAAGGUGCGGGGCUAGGGCUAACAGCAGUCUUACUGAAGGUUUCCUGGAAACCAC
  GCACAUGCUGUUGCCACUAACCUCAACCUUACUCGGUC

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Carboplatin

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: T98G cells; Brain; Homo sapiens (Human); CVCL_0556
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry analysis
• Mechanism Description: Here, we investigated the role of miR-744-5p in apoptosis signalling in ovarian cancer cell lines. MiR-744-5p expression was reduced in the cancer cell lines independent of the host gene MAP2K4. Overexpression of miR-744-5p activated the intrinsic apoptotic pathway in SKOV3, OVCAR3 and Cisplatin resistant (A2780-cis) and non-resistant A2780 cells leading to cell death. Notably, miR-744-5p overexpression together with Carboplatin treatment led to at least additive pro-apoptotic effects. Investigation of the apoptotic signalling pathways mediated by miR-744-5p revealed that its elevated expression directly downregulated mRNA and protein expression of nuclear factor I X (NFIX) and heterogeneous nuclear ribonucleoprotein C (HNRNPC). HNRNPC caused diminished miR-21 expression and AKT phosphorylation, while NFIX decreased Bcl2 levels, leading to the detected pro-apoptotic effects. Finally, Kaplan-Meier-Plots showed a prolonged median disease-free survival in ovarian serous cystadenocarcinoma patients with high miR-744 expression.

Cisplatin

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: T98G cells; Brain; Homo sapiens (Human); CVCL_0556
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry analysis
• Mechanism Description: Here, we investigated the role of miR-744-5p in apoptosis signalling in ovarian cancer cell lines. MiR-744-5p expression was reduced in the cancer cell lines independent of the host gene MAP2K4. Overexpression of miR-744-5p activated the intrinsic apoptotic pathway in SKOV3, OVCAR3 and Cisplatin resistant (A2780-cis) and non-resistant A2780 cells leading to cell death. Notably, miR-744-5p overexpression together with Carboplatin treatment led to at least additive pro-apoptotic effects. Investigation of the apoptotic signalling pathways mediated by miR-744-5p revealed that its elevated expression directly downregulated mRNA and protein expression of nuclear factor I X (NFIX) and heterogeneous nuclear ribonucleoprotein C (HNRNPC). HNRNPC caused diminished miR-21 expression and AKT phosphorylation, while NFIX decreased Bcl2 levels, leading to the detected pro-apoptotic effects. Finally, Kaplan-Meier-Plots showed a prolonged median disease-free survival in ovarian serous cystadenocarcinoma patients with high miR-744 expression.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

References

• Ref 1: Metallo-Beta-lactamase expression confers an advantage to Pseudomonas aeruginosa isolates compared with other Beta-lactam resistance mechanisms, favoring the prevalence of metallo-Beta-lactamase producers in a clinical environment. Microb Drug Resist. 2010 Sep;16(3):223-30. doi: 10.1089/mdr.2010.0016.
• Ref 2: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 3: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 4: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.