Molecule Information

General Information of the Molecule (ID: Mol05807)

• Name: hsa-miR-515-1 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  UCUCAUGCAGUCAUUCUCCAAAAGAAAGCACUUUCUGUUGUCUGAAAGCAGAGUGCCUUC
  UUUUGGAGCGUUACUGUUUGAGA

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Paclitaxel

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant glioma [ICD-11: 2A00.02] [1]

• Sensitive Disease: Malignant glioma [ICD-11: 2A00.02]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: MCAS cells; Ovary; Homo sapiens (Human); CVCL_3020
• In Vitro Model: OVCA429 cells; Ovary; Homo sapiens (Human); CVCL_3936
• In Vitro Model: OVCA432 cells; Ovary; Homo sapiens (Human); CVCL_3769
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• In Vitro Model: PEO1 cells; Ovary; Homo sapiens (Human); CVCL_2686
• In Vitro Model: PEO4 cells; Ovary; Homo sapiens (Human); CVCL_2690
• In Vitro Model: TOV-112D cells; Ovary; Homo sapiens (Human); CVCL_3612
• In Vitro Model: TOV21G cells; Ovary; Homo sapiens (Human); CVCL_3613
• In Vitro Model: OVCAR10 cells; Ovary; Homo sapiens (Human); CVCL_4377
• In Vitro Model: OVCAR8 cells; Ovary; Homo sapiens (Human); CVCL_1629
• In Vitro Model: OVCAR5 cells; Ovary; Homo sapiens (Human); CVCL_1628
• In Vitro Model: OVCAR4 cells; Ovary; Homo sapiens (Human); CVCL_1627
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Based on miRNA expression and GI50 data, Pearson's correlation test identified 35 miRNAs associated with in vitro paclitaxel sensitivity (P<0.05).

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K-AKT signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell cycle pathways; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell viability assay; Cell cycle assays; Apoptosis assay
• Mechanism Description: Our findings indicate that tamoxifen-resistant cells express miRNA-519a at high levels, which directly represses the expression of PTEN, RB1, and CDKN1A, central nodes of a dense network, allowing the cells to proliferate, even in the presence of tamoxifen.

Topotecan

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Topotecan
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: TOV21G cells; Ovary; Homo sapiens (Human); CVCL_3613
• In Vitro Model: TOV112D cells; Ovary; Homo sapiens (Human); CVCL_3612
• In Vitro Model: C13 cells; Ovary; Homo sapiens (Human); CVCL_0114
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vitro Model: A2780CP cells; Ovary; Homo sapiens (Human); CVCL_0135
• In Vitro Model: A2780s cells; Ovary; Homo sapiens (Human); CVCL_4863
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: OVCAR5 cells; Ovary; Homo sapiens (Human); CVCL_1628
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: miRNA probe assay
• Experiment for Drug Resistance: Cell proliferation assays
• Mechanism Description: MicroRNAs (miRNAs) are 19 to 25-nucleotide, non-coding, RNA transcripts, thought to be instrumental in controlling eukaryotic cell function via modulation of post-transcriptional activity of multiple target mRNA genes by repression of translation or regulation of mRNA degradation.

References

• Ref 1: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 2: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 3: Sequential development of mutant clones in an imatinib resistant chronic myeloid leukaemia patient following sequential treatment with multiple tyrosine kinase inhibitors: an emerging problem . Cancer Chemother Pharmacol. 2009 Jun;64(1):195-7. doi: 10.1007/s00280-008-0905-5. Epub 2009 Jan 21.