Molecule Information

General Information of the Molecule (ID: Mol05792)

• Name: hsa-miR-3127 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  GGCCAGGCCCAUCAGGGCUUGUGGAAUGGGAAGGAGAAGGGACGCUUCCCCUUCUGCAGG
  CCUGCUGGGUGUGGCU

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/ERK signaling; Regulation; N.A.
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• Experiment for Molecule Alteration: qRT-PCR, microarray assay
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Among these miRs, 7 (miR-224, miR-424-3p, miR-130a, miR-224-star, miR-452, miR-181a-2-star, and miR-193b-5p) were downregulated in the PTX-resistant GC cell line, whereas the other 3 miRs (miR-3127-5p, miR-1287, and miR-4713-5p) were upregulated in the PTX-resistant GC cell line compared to the PTX-sensitive GC cell line. AKT/ERK signaling was active in the PTX-resistant GC cell line.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.