Molecule Information

General Information of the Molecule (ID: Mol05762)

• Name: hsa-miR-181a-1 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  UGAGUUUUGAGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUAAAAUC
  AAAACCAUCGACCGUUGAUUGUACCCUAUGGCUAACCAUCAUCUACUCCA

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: TOV21G cells; Ovary; Homo sapiens (Human); CVCL_3613
• In Vitro Model: TOV112D cells; Ovary; Homo sapiens (Human); CVCL_3612
• In Vitro Model: C13 cells; Ovary; Homo sapiens (Human); CVCL_0114
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vitro Model: A2780CP cells; Ovary; Homo sapiens (Human); CVCL_0135
• In Vitro Model: A2780s cells; Ovary; Homo sapiens (Human); CVCL_4863
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: OVCAR5 cells; Ovary; Homo sapiens (Human); CVCL_1628
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: miRNA probe assay
• Experiment for Drug Resistance: Cell proliferation assays
• Mechanism Description: MicroRNAs (miRNAs) are 19 to 25-nucleotide, non-coding, RNA transcripts, thought to be instrumental in controlling eukaryotic cell function via modulation of post-transcriptional activity of multiple target mRNA genes by repression of translation or regulation of mRNA degradation.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray profiling, TaqMan Reverse Transcription (RT)-PCR for miRNA Quantification
• Experiment for Drug Resistance: Cell Proliferation Assay, Apoptosis Assay
• Mechanism Description: miRNA microarray analysis of MCF-7 cell lines that are either sensitive (parental) or resistant (4-hydroxytamoxifen-resistant (OHTR)) to tamoxifen showed significant (>1.8-fold) up-regulation of eight miRNAs and marked down-regulation (>50%) of seven miRNAs in OHTRcells compared with parental MCF-7 cells.

References

• Ref 1: Sequential development of mutant clones in an imatinib resistant chronic myeloid leukaemia patient following sequential treatment with multiple tyrosine kinase inhibitors: an emerging problem . Cancer Chemother Pharmacol. 2009 Jun;64(1):195-7. doi: 10.1007/s00280-008-0905-5. Epub 2009 Jan 21.
• Ref 2: MicroRNA-221/222 confers tamoxifen resistance in breast cancer by targeting p27Kip1. J Biol Chem. 2008 Oct 31;283(44):29897-903. doi: 10.1074/jbc.M804612200. Epub 2008 Aug 15.