Molecule Information

General Information of the Molecule (ID: Mol05718)

• Name: hsa-miR-371a-3p ,Homo sapiens
• Molecule Type: Mature miRNA
• Sequence: AAGUGCCGCCAUCUUUUGAGUGU

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Testicular germ cell tumor [ICD-11: 2C80.0] [1]

• Resistant Disease: Testicular germ cell tumor [ICD-11: 2C80.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: NCCIT cells; Embryo; Homo sapiens (Human); CVCL_1451
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Crystal violet assay; Flow cytometry assay
• Mechanism Description: MicroRNA-371a-3p (miR-371), the new serum biomarker for TGCTs, shows significantly increased expression in cisplatin-resistant TGCT cell lines compared to sensitive parental cell lines. However, the functional impact of miR-371 on cisplatin sensitivity has not been investigated yet. To evaluate the impact of miR-371 on cisplatin sensitivity, antagomirs were used to inhibit miR-371 expression, resulting in a > 98% decrease in miR-371 expression. Cisplatin sensitivity was significantly increased after miR-371 inhibition in cisplatin-resistant and corresponding parental TGCT cell lines, indicating a strongly reduced viability and increased apoptosis after cisplatin treatment in miR-371-inhibited cells. Our results suggest that miR-371 may contribute to the development of cisplatin resistance in TGCTs. Interfering with miR-371 expression can increase the cisplatin sensitivity of tumour cells, which may represent a promising approach to improve future therapeutic outcomes in patients with TGCTs, especially those with cisplatin-resistant disease.

References

• Ref 1: MicroRNA-212-3p inhibits paclitaxel resistance through regulating epithelial-mesenchymal transition, migration and invasion by targeting ZEB2 in human hepatocellular carcinoma. Oncol Lett. 2020 Oct 20(4):23