Molecule Information

General Information of the Molecule (ID: Mol05682)

• Name: hsa-miR-99b-3p ,Homo sapiens
• Molecule Type: Mature miRNA
• Sequence: CAAGCUCGUGUCUGUGGGUCCG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.0] [1]

• Resistant Disease: Lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-qPCR
• Mechanism Description: We found that miR-96-5p and miR-6815-5p were notably downregulated in the nonresponder group, while miR-99b-3p, miR-100-5p, miR-193a-5p, and miR-320d were upregulated.

References

• Ref 1: MicroRNA-212-3p inhibits paclitaxel resistance through regulating epithelial-mesenchymal transition, migration and invasion by targeting ZEB2 in human hepatocellular carcinoma. Oncol Lett. 2020 Oct 20(4):23