Molecule Information

General Information of the Molecule (ID: Mol05316)

• Name: hsa-miR-518e-5p ,Homo sapiens
• Molecule Type: Mature miRNA
• Sequence: CUCUAGAGGGAAGCGCUUUCUG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.1] [1]

• Resistant Disease: Gastrointestinal stromal tumor [ICD-11: 2B5B.1]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Gastrointestinal stromal tumor patients; Homo sapiens
• Experiment for Molecule Alteration: Immunohistochemistry; DNA sequencing; Taqman PCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Serum miR- 518e-5p and miR-548e levels were higher in secondary imatinib-resistant GIST than imatinib-sensitive GIST patients or healthy controls (P less than 0.0001).

References

• Ref 1: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.