Molecule Information

General Information of the Molecule (ID: Mol05309)

• Name: hsa-miR-28-5p ,Homo sapiens
• Molecule Type: Mature miRNA
• Sequence: AAGGAGCUCACAGUCUAUUGAG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.1] [1]

• Resistant Disease: Gastrointestinal stromal tumor [ICD-11: 2B5B.1]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: Microarray analyses
• Mechanism Description: Among the five miRNAs, the overexpression of hsa-miR-28-5p and hsa-miR-125a-5p had significant correlation to imatinib resistance or imatinib sensitivity in GIST patients

References

• Ref 1: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.