Molecule Information

General Information of the Molecule (ID: Mol05300)

• Name: hsa-miR-519c ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  UCUCAGCCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAGUGC
  AUCUUUUUAGAGGAUUACAGUUUGAGA

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [ICD-11: 2C30.0] [1], [2], [3]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: NEAT1-miR-519c-3p-MeCP2 axis; Regulation; N.A.
• In Vitro Model: HT144 cells; Skin; Homo sapiens (Human); CVCL_0318
• In Vitro Model: M14 cells; Hypodermis; Homo sapiens (Human); CVCL_1395
• In Vitro Model: GAK cells; Lnguinal lymph node; Homo sapiens (Human); CVCL_1225
• In Vitro Model: SkMEL5 cells; Skin; Homo sapiens (Human); CVCL_0527
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• In Vivo Model: Melanoma tumor and adjacent normal skin tissues model; Nude mouse xenograft model; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR; RNA pull-down assay; Luciferase assay; Western blot
• Experiment for Drug Resistance: Cell viability assay; Clonogenic assay; Cell apoptosis assay
• Mechanism Description: In summary, our results unveiled biological roles and molecular mechanisms of the noncoding RNA-mediated cisplatin resistance in melanoma, suggesting blocking the NEAT1-miR-519c-3p-MeCP2 axis as a therapeutic strategy against chemoresistant melanoma.

Mitoxantrone

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.2]
• Sensitive Drug: Mitoxantrone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: BCRP/ABCG2; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry analysis
• Mechanism Description: Our data suggest that miR-519c and -328 have greater impact on ABCG2 expression than miR-520h in MCF-7 human breast cancer cells, and the presence of proximal miR-519c MRE explains the action of miR-519c on shortened ABCG2 3'UTR.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K-AKT signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell cycle pathways; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell viability assay; Cell cycle assays; Apoptosis assay
• Mechanism Description: Our findings indicate that tamoxifen-resistant cells express miRNA-519a at high levels, which directly represses the expression of PTEN, RB1, and CDKN1A, central nodes of a dense network, allowing the cells to proliferate, even in the presence of tamoxifen.

References

• Ref 1: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 2: Linc00221 modulates cisplatin resistance in non-small-cell lung cancer via sponging miR-519aBiochimie. 2019 Jul;162:134-143. doi: 10.1016/j.biochi.2019.04.019. Epub 2019 Apr 25.
• Ref 3: MiR-519d impedes cisplatin-resistance in breast cancer stem cells by down-regulating the expression of MCL-1. Oncotarget. 2017 Mar 28;8(13):22003-22013. doi: 10.18632/oncotarget.15781.
• Ref 4: miR-143 decreases prostate cancer cells proliferation and migration and enhances their sensitivity to docetaxel through suppression of KRAS. Mol Cell Biochem. 2011 Apr;350(1-2):207-13. doi: 10.1007/s11010-010-0700-6. Epub 2011 Jan 1.
• Ref 5: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.