Molecule Information

General Information of the Molecule (ID: Mol05157)

Name	hsa-miR-1914 ,Homo sapiens
Molecule Type	Precursor miRNA
Sequence	CGUGUGAGCCCGCCCUGUGCCCGGCCCACUUCUGCUUCCUCUUAGCGCAGGAGGGGUCCC GCACUGGGAGGGGCCCUCAC Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Oxaliplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)		Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1]			[2]
Resistant Disease	Colorectal cancer [ICD-11: 2B91.1]		Disease Info
Resistant Drug	Oxaliplatin		Drug Info
Molecule Alteration	Expression	Down-regulation
Experimental Note	Identified from the Human Clinical Data
Mechanism Description	Plasma levels of miR-1914* and -1915 in chemoresistant CRC patients were different than levels in responders, and associated with clinical response. Overexpression of miR-1914* and -1915 in chemoresistant CRC cells reduced resistance to 5-FU and Oxaliplatin in vitro. The microRNAs suppressed chemoresistance in CRC tumors in mice by affecting cell growth, invasion, apoptosis and tumor suppressor function. miR-1914* and -1915 interacted with the 3'-untranslated region of NFIX and reduced NFIX its level in chemoresistant CRC cells. Overexpression of NFIX did not inhibit chemoresistant CRC cell motility and chemoresistant proteins when miR-1914* and -1915 were transfected.

References

Ref 1	Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 2	Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.