Molecule Information
General Information of the Molecule (ID: Mol05108)
| Name |
hsa-miR-188
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Molecule Type |
Precursor miRNA
|
||||
| Sequence |
UGCUCCCUCUCUCACAUCCCUUGCAUGGUGGAGGGUGAGCUUUCUGAAAACCCCUCCCAC
AUGCAGGGUUUGCAGGAUGGCGAGCC Click to Show/Hide
|
||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] | [2] | |||
| Resistant Disease | Oral squamous cell carcinoma [ICD-11: 2B6E.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | Tca8113 cells | Tongue | Homo sapiens (Human) | CVCL_6851 |
| Experiment for Molecule Alteration |
RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
Growth inhibition assay | |||
| Mechanism Description | miR-23a is an up-stream regulator of TOP2B to realize the chemoresistance of cisplatin. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
