Molecule Information

General Information of the Molecule (ID: Mol05108)

• Name: hsa-miR-188 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  UGCUCCCUCUCUCACAUCCCUUGCAUGGUGGAGGGUGAGCUUUCUGAAAACCCCUCCCAC
  AUGCAGGGUUUGCAGGAUGGCGAGCC

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] [2]

• Resistant Disease: Oral squamous cell carcinoma [ICD-11: 2B6E.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Tca8113 cells; Tongue; Homo sapiens (Human); CVCL_6851
• Experiment for Molecule Alteration: RT-PCR; Western blot
• Experiment for Drug Resistance: Growth inhibition assay
• Mechanism Description: miR-23a is an up-stream regulator of TOP2B to realize the chemoresistance of cisplatin.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: MicroRNAs contribute to the chemoresistance of cisplatin in tongue squamous cell carcinoma lines. Oral Oncol. 2010 Apr;46(4):317-22. doi: 10.1016/j.oraloncology.2010.02.002. Epub 2010 Mar 9.
• Ref 3: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.