Molecule Information

General Information of the Molecule (ID: Mol04184)
Name
microRNA-99b-5p (miR-99b-5p) ,Homo sapiens
Synonyms
microRNA 99b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CACCCGUAGAACCGACCUUGCG
    Click to Show/Hide
Ensembl ID
ENSG00000207550
HGNC ID
HGNC:31651
Mature Accession
MIMAT0000689
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  MRAP: Metabolic Reprogramming via Altered Pathways
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Enzalutamide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Metabolic Reprogramming via Altered Pathways (MRAP) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [1]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Sensitive Drug Enzalutamide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation HIF-1 signaling pathway Activation hsa04066
VEGF signaling pathway Activation hsa04370
In Vitro Model MDA PCa 2b cells Prostate Homo sapiens (Human) CVCL_4748
Experiment for
Molecule Alteration		 qRT-PCR; Western blot analysis
Experiment for
Drug Resistance		 Colony formation assay
Mechanism Description On the other hand, overexpression of miR-99b-5p (i.e. via transfection of miR-99b-5p mimic) targets/inhibits AR, mTOR and SMARCD1 simultaneously and blocks the translocation of mTOR/AR/SMARCD1 complex from cytoplasm to nucleus, consequently suppressing cell proliferation/survival and enhancing the cell apoptosis in PCa (especially AA PCA and CRPC). Furthermore, miR-99b-10p overexpression results in suppressing nuclear translocation of
Disease Class: Prostate cancer [ICD-11: 2C82.0] [1]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Sensitive Drug Enzalutamide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation HIF-1 signaling pathway Activation hsa04066
VEGF signaling pathway Activation hsa04370
In Vitro Model PC-3 cells Bone Homo sapiens (Human) CVCL_0035
Experiment for
Molecule Alteration		 qRT-PCR; Western blot analysis
Experiment for
Drug Resistance		 Colony formation assay
Mechanism Description On the other hand, overexpression of miR-99b-5p (i.e. via transfection of miR-99b-5p mimic) targets/inhibits AR, mTOR and SMARCD1 simultaneously and blocks the translocation of mTOR/AR/SMARCD1 complex from cytoplasm to nucleus, consequently suppressing cell proliferation/survival and enhancing the cell apoptosis in PCa (especially AA PCA and CRPC). Furthermore, miR-99b-5p overexpression results in suppressing nuclear translocation of
Disease Class: Prostate cancer [ICD-11: 2C82.0] [1]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Sensitive Drug Enzalutamide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation HIF-1 signaling pathway Activation hsa04066
VEGF signaling pathway Activation hsa04370
In Vitro Model DU145 cells Prostate Homo sapiens (Human) CVCL_0105
Experiment for
Molecule Alteration		 qRT-PCR; Western blot analysis
Experiment for
Drug Resistance		 Colony formation assay
Mechanism Description On the other hand, overexpression of miR-99b-5p (i.e. via transfection of miR-99b-5p mimic) targets/inhibits AR, mTOR and SMARCD1 simultaneously and blocks the translocation of mTOR/AR/SMARCD1 complex from cytoplasm to nucleus, consequently suppressing cell proliferation/survival and enhancing the cell apoptosis in PCa (especially AA PCA and CRPC). Furthermore, miR-99b-6p overexpression results in suppressing nuclear translocation of
Disease Class: Prostate cancer [ICD-11: 2C82.0] [1]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Sensitive Drug Enzalutamide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation HIF-1 signaling pathway Activation hsa04066
VEGF signaling pathway Activation hsa04370
In Vitro Model LNCaP cells Prostate Homo sapiens (Human) CVCL_0395
Experiment for
Molecule Alteration		 qRT-PCR; Western blot analysis
Experiment for
Drug Resistance		 Colony formation assay
Mechanism Description On the other hand, overexpression of miR-99b-5p (i.e. via transfection of miR-99b-5p mimic) targets/inhibits AR, mTOR and SMARCD1 simultaneously and blocks the translocation of mTOR/AR/SMARCD1 complex from cytoplasm to nucleus, consequently suppressing cell proliferation/survival and enhancing the cell apoptosis in PCa (especially AA PCA and CRPC). Furthermore, miR-99b-7p overexpression results in suppressing nuclear translocation of
Disease Class: Prostate cancer [ICD-11: 2C82.0] [1]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Sensitive Drug Enzalutamide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation HIF-1 signaling pathway Activation hsa04066
VEGF signaling pathway Activation hsa04370
In Vitro Model 22Rv-1 cells Prostate Homo sapiens (Human) CVCL_1045
Experiment for
Molecule Alteration		 qRT-PCR; Western blot analysis
Experiment for
Drug Resistance		 Colony formation assay
Mechanism Description On the other hand, overexpression of miR-99b-5p (i.e. via transfection of miR-99b-5p mimic) targets/inhibits AR, mTOR and SMARCD1 simultaneously and blocks the translocation of mTOR/AR/SMARCD1 complex from cytoplasm to nucleus, consequently suppressing cell proliferation/survival and enhancing the cell apoptosis in PCa (especially AA PCA and CRPC). Furthermore, miR-99b-8p overexpression results in suppressing nuclear translocation of
Disease Class: Prostate cancer [ICD-11: 2C82.0] [1]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Sensitive Drug Enzalutamide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation HIF-1 signaling pathway Activation hsa04066
VEGF signaling pathway Activation hsa04370
In Vitro Model C4-2B cells Prostate Homo sapiens (Human) CVCL_4784
Experiment for
Molecule Alteration		 qRT-PCR; Western blot analysis
Experiment for
Drug Resistance		 Colony formation assay
Mechanism Description On the other hand, overexpression of miR-99b-5p (i.e. via transfection of miR-99b-5p mimic) targets/inhibits AR, mTOR and SMARCD1 simultaneously and blocks the translocation of mTOR/AR/SMARCD1 complex from cytoplasm to nucleus, consequently suppressing cell proliferation/survival and enhancing the cell apoptosis in PCa (especially AA PCA and CRPC). Furthermore, miR-99b-9p overexpression results in suppressing nuclear translocation of
References
Ref 1 Tumor suppressive miR-99b-5p as an epigenomic regulator mediating mTOR/AR/SMARCD1 signaling axis in aggressive prostate cancer. Front Oncol. 2023 Nov 7;13:1184186.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.