Molecule Information

General Information of the Molecule (ID: Mol04182)

Name	microRNA-23b-3p (miR-23b-3p) ,Homo sapiens
Synonyms	microRNA 23b Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	AUCACAUUGCCAGGGAUUACCAC Click to Show/Hide
Ensembl ID	ENSG00000207563
HGNC ID	HGNC:31606
Mature Accession	MIMAT0000418
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

MRAP: Metabolic Reprogramming via Altered Pathways

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Sorafenib

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Metabolic Reprogramming via Altered Pathways (MRAP)			Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.02]				[1]
Metabolic Type	Glutamine metabolism
Resistant Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]			Disease Info
Resistant Drug	Sorafenib			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	HepG2 cells	Liver	Homo sapiens (Human)	CVCL_0027
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	IC50 assay
Mechanism Description	NGS and real-time PCR demonstrated the downregulated expression of miR-23b-3p in sorafenib-resistant cells compared to parental cells. In silico analysis showed that miR-23b-3p specifically targeted autophagy through ATG12 and glutaminolysis through GLS1. In transfection assays, mimics of miR-23b-3p demonstrated reduced gene expression for both ATG12 and GLS1, decreased cell viability, and increased cell apoptosis of sorafenib-resistant HepG2 cells, whereas the antimiRs of miR-23b-3p demonstrated contrasting results.

References

Ref 1	miR-23b-3p Modulating Cytoprotective Autophagy and Glutamine Addiction in Sorafenib Resistant HepG2, a Hepatocellular Carcinoma Cell Line. Genes (Basel). 2022 Aug 1;13(8):1375.