Molecule Information
General Information of the Molecule (ID: Mol04181)
| Name |
microRNA-139-5p (miR-139-5p)
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 139
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UCUACAGUGCACGUGUCUCCAGU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Castration-resistant prostate cancer [ICD-11: 2C82.0] | [1] | |||
| Metabolic Type | Glucose metabolism | |||
| Resistant Disease | Castration-resistant prostate cancer [ICD-11: 2C82.0] | |||
| Resistant Drug | Enzalutamide | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Central carbon metabolism in cancer | Activation | hsa05230 | |
| In Vitro Model | C4-2 cells | Prostate | Homo sapiens (Human) | CVCL_4782 |
| Experiment for Molecule Alteration |
qRT-PCR; Western blot analysis | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Mechanistic dissection demonstrated that lncRNA SNHG3 facilitated the advance of CRPC by adjusting the expression of PKM2. Further explorations unraveled the role of lncRNA SNHG3 as a 'sponge' of miR-139-5p and released its binding with PKM2 mRNA, leading to PKM2 up-regulation. Together, Our studies suggest that lncRNA SNHG3 / miR-139-5p / PKM3 pathway promotes the development of CRPC via regulating glycolysis process and provides valuable insight into a novel therapeutic approach for the disordered disease. | |||
| Disease Class: Castration-resistant prostate cancer [ICD-11: 2C82.0] | [1] | |||
| Metabolic Type | Glucose metabolism | |||
| Resistant Disease | Castration-resistant prostate cancer [ICD-11: 2C82.0] | |||
| Resistant Drug | Enzalutamide | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Central carbon metabolism in cancer | Activation | hsa05230 | |
| In Vivo Model | 4-weeks-old male nude mice, with empty vector, sh-LncRNA SNHG3, sh-PKM2, sh-LncRNA SNHG3 + sh-PKM3 were separately injected | Mice | ||
| Experiment for Molecule Alteration |
qRT-PCR; Western blot analysis | |||
| Experiment for Drug Resistance |
Tumor weight assay | |||
| Mechanism Description | Mechanistic dissection demonstrated that lncRNA SNHG3 facilitated the advance of CRPC by adjusting the expression of PKM2. Further explorations unraveled the role of lncRNA SNHG3 as a 'sponge' of miR-139-5p and released its binding with PKM2 mRNA, leading to PKM2 up-regulation. Together, Our studies suggest that lncRNA SNHG3 / miR-139-5p / PKM6 pathway promotes the development of CRPC via regulating glycolysis process and provides valuable insight into a novel therapeutic approach for the disordered disease. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
