Molecule Information

General Information of the Molecule (ID: Mol04180)

• Name: microRNA-137 (miR-137) ,Homo sapiens
• Synonyms: microRNA 137
• Molecule Type: Mature miRNA
• Sequence: ACGGGUAUUCUUGGGUGGAUAAU
• Ensembl ID: ENSG00000284202
• HGNC ID: HGNC:31523
• Mature Accession: MIMAT0000429

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  MRAP: Metabolic Reprogramming via Altered Pathways

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Metabolic Reprogramming via Altered Pathways (MRAP)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]

• Metabolic Type: Glutamine metabolism
• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: HCT-116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: SW-480 cells; Colon; Homo sapiens (Human); CVCL_0546
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Using a microRNA (miRNA) microArray assay, miR-137, a tumor suppressor in colon cancer, was significantly induced by curcumin treatments in CRC cells. Bioinformatics analysis and a luciferase assay illustrated miR-137 directly targeted the 3' UTR of GLS mRNA. Rescue experiments demonstrated that miR-137-induced cisplatin sensitization was through targeting of GLS. Finally, curcumin treatment overcame cisplatin resistance through miR-137-mediated glutamine inhibition.

Curcumin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Metabolic Reprogramming via Altered Pathways (MRAP)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]

• Metabolic Type: Glutamine metabolism
• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Curcumin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: HCT-116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: SW-480 cells; Colon; Homo sapiens (Human); CVCL_0546
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Using a microRNA (miRNA) microArray assay, miR-137, a tumor suppressor in colon cancer, was significantly induced by curcumin treatments in CRC cells. Bioinformatics analysis and a luciferase assay illustrated miR-137 directly targeted the 3' UTR of GLS mRNA. Rescue experiments demonstrated that miR-137-induced cisplatin sensitization was through targeting of GLS. Finally, curcumin treatment overcame cisplatin resistance through miR-137-mediated glutamine inhibition.

References

• Ref 1: Curcumin Synergizes with Cisplatin to Inhibit Colon Cancer through Targeting the MicroRNA-137-Glutaminase Axis. Curr Med Sci. 2022 Feb;42(1):108-117.