Molecule Information

General Information of the Molecule (ID: Mol01772)

• Name: hsa-miR-487b-5p ,Homo sapiens
• Synonyms: microRNA 487b
• Molecule Type: Mature miRNA
• Sequence: GUGGUUAUCCCUGUCCUGUUCG
• Ensembl ID: ENSG00000207754
• HGNC ID: HGNC:32533
• Mature Accession: MIMAT0026614

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [1]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-487b-5p regulates temozolomide resistance of lung cancer cells through lamp2-medicated autophagy.

References

• Ref 1: miR-487b-5p Regulates Temozolomide Resistance of Lung Cancer Cells Through LAMP2-Medicated Autophagy. DNA Cell Biol. 2016 Aug;35(8):385-92. doi: 10.1089/dna.2016.3259. Epub 2016 Apr 20.