Molecule Information
General Information of the Molecule (ID: Mol01769)
Name |
hsa-miR-5100
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 5100
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UUCAGAUCCCAGCGGUGCCUCU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [1] | |||
Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Mitochondrial apoptotic signaling pathway | Activation | hsa04210 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CD44/CD133 assay; MTT assay | |||
Mechanism Description | miR5100 increases the cisplatin resistance of the lung cancer stem cells by inhibiting the Rab6. miR5100 increases cisplatin resistance via the mitochondrial apoptosis pathway. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.