Molecule Information

General Information of the Molecule (ID: Mol01769)

• Name: hsa-miR-5100 ,Homo sapiens
• Synonyms: microRNA 5100
• Molecule Type: Mature miRNA
• Sequence: UUCAGAUCCCAGCGGUGCCUCU
• Ensembl ID: ENSG00000263795
• HGNC ID: HGNC:43540
• Mature Accession: MIMAT0022259

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [1]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Mitochondrial apoptotic signaling pathway; Activation; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CD44/CD133 assay; MTT assay
• Mechanism Description: miR5100 increases the cisplatin resistance of the lung cancer stem cells by inhibiting the Rab6. miR5100 increases cisplatin resistance via the mitochondrial apoptosis pathway.

References

• Ref 1: MiR-5100 increases the cisplatin resistance of the lung cancer stem cells by inhibiting the Rab6. Mol Carcinog. 2018 Mar;57(3):419-428. doi: 10.1002/mc.22765. Epub 2017 Dec 1.