Molecule Information
General Information of the Molecule (ID: Mol01760)
Name |
hsa-miR-3127-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 3127
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AUCAGGGCUUGUGGAAUGGGAAG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Dasatinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Abl/RAS/ERK signaling pathway | Activation | hsa04010 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | H292 cells | Lung | Homo sapiens (Human) | CVCL_0455 |
A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Reduced miR-3127-5p expression promotes NSCLC proliferation/invasion and contributes to dasatinib sensitivity via the c-Abl/Ras/ERk pathway. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.