Molecule Information

General Information of the Molecule (ID: Mol01754)

• Name: hsa-miR-1244 ,Homo sapiens
• Synonyms: microRNA 1244-1
• Molecule Type: Mature miRNA
• Sequence: AAGUAGUUGGUUUGUAUGAGAUGGUU
• Ensembl ID: ENSG00000284378
• HGNC ID: HGNC:35310
• Mature Accession: MIMAT0005896

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Caspase-3 signaling pathway; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: NCI-H522 cells; Lung; Homo sapiens (Human); CVCL_1567
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; LDH assay; Flow cytometric analysis
• Mechanism Description: Overexpression of miR1244 suppressed cell viability and increased LDH toxicity in cisplatin-treated A549 and NCI-H522 cells and induced the apoptosis of cisplatin-treated A549 and NCI-H522 cells. Overexpression of miR1244 promoted caspase-3 activity and p53 and Bax protein expression, and suppressed MEF2D and cyclin D1 protein expression in cisplatin treated A549 and NCI-H522 cells.

References

• Ref 1: Effect of miR-1244 on cisplatin-treated non-small cell lung cancer via MEF2D expression. Oncol Rep. 2017 Jun;37(6):3475-3483. doi: 10.3892/or.2017.5624. Epub 2017 May 4.