Molecule Information

General Information of the Molecule (ID: Mol01752)

• Name: hsa-miR-1294 ,Homo sapiens
• Synonyms: microRNA 1294
• Molecule Type: Mature miRNA
• Sequence: UGUGAGGUUGGCAUUGUUGUCU
• Ensembl ID: ENSG00000221430
• HGNC ID: HGNC:35287
• Mature Accession: MIMAT0005884

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Overexpression of miR-1294 ameliorated cisplatin-resistant OC malignancy via inhibiting IGF1R.

References

• Ref 1: MiR-1294 confers cisplatin resistance in ovarian Cancer cells by targeting IGF1R. Biomed Pharmacother. 2018 Oct;106:1357-1363. doi: 10.1016/j.biopha.2018.07.059. Epub 2018 Jul 23.