Molecule Information

General Information of the Molecule (ID: Mol01749)

• Name: hsa-miR-1204 ,Homo sapiens
• Synonyms: microRNA 1204
• Molecule Type: Mature miRNA
• Sequence: UCGUGGCCUGGUCUCCAUUAU
• Ensembl ID: ENSG00000283710
• HGNC ID: HGNC:37059
• Mature Accession: MIMAT0005868

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Nasopharyngeal carcinoma [1]

• Sensitive Disease: Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: 5-8F cells; Nasopharynx; Homo sapiens (Human); CVCL_C528
• In Vitro Model: CNE1 cells; Throat; Homo sapiens (Human); CVCL_6888
• In Vitro Model: HNE-2 cells; Nasopharynx; Homo sapiens (Human); CVCL_FA07
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay
• Mechanism Description: miR-1204 sensitizes nasopharyngeal carcinoma cells to paclitaxel both in vitro and in vivo via inhibitsing tumor growth in vivo significantly.

References

• Ref 1: MiR-1204 sensitizes nasopharyngeal carcinoma cells to paclitaxel both in vitro and in vivo. Cancer Biol Ther. 2015;16(2):261-7. doi: 10.1080/15384047.2014.1001287.