Molecule Information
General Information of the Molecule (ID: Mol01746)
Name |
hsa-miR-1182
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 1182
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
GAGGGUCUUGGGAGGGAUGUGAC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [1] | |||
Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | BCa cells | Bladder | Homo sapiens (Human) | N.A. |
Hcv29 cells | Bladder | Homo sapiens (Human) | CVCL_8228 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-1182 was significantly downregulated in bladder cancer cells and tumor tissues. miR-1182 inhibited cell proliferation and invasion, induced apoptosis and cell cycle arrest, and mediated the chemosensitivity of bladder cancer cells to cisplatin by targeting hTERT. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.